Labshake search
Citations for Millipore Sigma :
301 - 350 of 10000+ citations for 6 Phenylamino 2 3 dihydro 1H indolizin 5 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... slides were washed in PBS and incubated in 5 μg/ml 4’,6-diamidino-2-phenylindole (DAPI; Sigma Aldrich) in PBS for 5 min ...
-
bioRxiv - Cancer Biology 2024Quote: ... slides were washed in PBS and incubated in 5 μg/ml 4’,6-diamidino-2-phenylindole (DAPI) (Sigma Aldrich) in PBS (Sigma Aldrich ...
-
bioRxiv - Biochemistry 2023Quote: Two complementary single strand oligonucleotides (5’-GTAATCTGGGCCACCTGCCTGGGAGGA-3’ and 5’-TCCTCCCAGGCAGGTGGCCCAGATTAC-3’) corresponding E2 box44 were Two complementary single strand oligonucleotides (5’-purchased from Sigma-Aldrich. An equal molar ratio of single strand oligonucleotides was mixed and incubated at 95°C for 5 min ...
-
bioRxiv - Cell Biology 2020Quote: ... blocked for one hour with 5% skim milk (Sigma 70166) in PBST and overnight incubated with primary antibodies diluted in 5% BSA (Sigma A2153 ...
-
Proteasome granular localization is regulated through mitochondrial respiration and kinase signalingbioRxiv - Cell Biology 2022Quote: ... and 2-[2-(3-chlorophenyl)hydrazinylidene]-propanedinitrile (CCCP) (Sigma), were used at final concentrations of 0.5 μM ...
-
bioRxiv - Biochemistry 2022Quote: ... 2-[2-(3-chlorophenyl)hydrazinylyidene]propanedinitrile (CCCP) (Sigma-Aldrich), rhodamine 123 ...
-
bioRxiv - Cancer Biology 2021Quote: ... mice were randomized in two groups of which one received henceforth 2 mg/ml DOX (BelaDox, Bela-pharm) dissolved in drinking water containing 5% sucrose (Sigma-Aldrich) to induce TCF7L1 re-expression (DOX (+)) ...
-
bioRxiv - Cancer Biology 2019Quote: ... mice were randomized in two groups of which one henceforth was treated with 2 mg/ml BelaDox (Bela-pharm, Germany) dissolved in drinking water containing 5% sucrose (Sigma-Aldrich) to induce an in vivo knockdown (Dox (+)) ...
-
bioRxiv - Cancer Biology 2023Quote: ... mice were randomized in two groups of which one received henceforth 2 mg/ml Dox (BelaDox, Bela-pharm) dissolved in drinking water containing 5% sucrose (Sigma-Aldrich) to induce sh4E-BP1_2 expression ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2-4 months old mice were orally gavaged with 3 x 2 (Mist1creERT/+KRASG12D/+) or 5 x 5 mg (Ptf1acreERT/+KRASG12D/+) of tamoxifen (TX; Sigma-Aldrich, T5648-5G) at Western University and 5 x 4 mg (Ela-creERT ...
-
bioRxiv - Biochemistry 2021Quote: ... 2-amino-3-phosphonopropionic acid (AP-3, Sigma-Aldrich A4910), ATP (Sigma-Aldrich A2383) ...
-
bioRxiv - Systems Biology 2022Quote: ... Cultures were treated with the indicated amount of 1-(1,1-dimethylethyl)-3-(1-naphthalenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-amine (1-NM-PP1; Millipore Sigma), taken from a 10,000x stock in DMSO ...
-
bioRxiv - Microbiology 2022Quote: ... the msfGFP levels were normalized for OD600 and converted to absolute units using 5(6)-carboxyfluorescein (5(6)-FAM) (Sigma Aldrich) as a calibrant (36 ...
-
bioRxiv - Microbiology 2023Quote: ... The relative msfGFP measurements were normalised for their respective OD600 values and subsequently converted to absolute units of the calibrant 5(6)-carboxyfluorescein (5(6)-FAM)) (Sigma-Aldrich). Finally ...
-
bioRxiv - Molecular Biology 2020Quote: ... The rANF single strands DNAs (5’-AGAGGTCATGAAGGACATT-3’ and 5’AATGTCCTTCATGACCTCT-3’) were purchased from Sigma Aldrich and annealed ...
-
bioRxiv - Biochemistry 2020Quote: ... P4 5’ CTTGTCGTCATCGTCTTTGTAGTCCTTGTC 3’ and P5 5’ CAGGAAACA GCTATGACCATG 3’ and KOD Hot Start DNA Polymerase (Millipore).
-
bioRxiv - Cell Biology 2021Quote: ... CEP192 knockdown was achieved by transfecting the oligo duplex: 5’-GGAAGACAUUUUCAUCUCUtt-3’ and 5’-AGAGAUGAAAAUGUCUUCCtt-3’ (Sigma).
-
bioRxiv - Biochemistry 2022Quote: ... The [5′-32P] cytidine 3′,5′-bisphosphate was prepared by incubating 1 mM cytidine 3′-monophosphate (Sigma) with 312.5 pmole [γ-32P] ATP (6000 Ci/mmol ...
-
bioRxiv - Developmental Biology 2023Quote: ... Signals (ΔCt) were normalized to GAPDH expression (GAPDHfw70 5’-CCACCCATGGCAAATCC-3’ and GAPDHrev70 5’-GATGGGATTTGCATTGATGACA-3’; Sigma). The amplification efficiencies were determined by serial dilution and calculated as E = 10-1/m × 100 ...
-
bioRxiv - Bioengineering 2020Quote: ... The patterned wafer was silanized with trichloro (1H, 1H, 2H, 2H-perfluorooctyl) silane (Sigma Aldrich, USA) to render the surface hydrophobic ...
-
bioRxiv - Bioengineering 2020Quote: ... nalidixic acid (NA; N8878, BCBW6556), and 4′,6-diamidino-2-phenylindole (DAPI; D9542, 28718-90-3) were purchased from Sigma Aldrich, USA ...
-
bioRxiv - Cell Biology 2022Quote: The neuroprotective effect of CA against 6-OHDA was evaluated by MTT reagent (3-(4,5-Dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide) (Sigma Aldrich, UK, M5655) according to the manufacturer’s instruction ...
-
bioRxiv - Immunology 2022Quote: ... After washed with PBS for 3 times and stained with DAPI (4’,6-diamidino-2-phenylindole) (50 ng/mL) (Sigma, USA) for 5 min ...
-
bioRxiv - Plant Biology 2020Quote: ... PGM buffer (6% mannitol, 3% sucrose, M5524 MS salts (Sigma), M7150 vitamins (Sigma) ...
-
bioRxiv - Neuroscience 2020Quote: ... Cultures were first incubated for 1h at room temperature in a blocking solution containing 2% BSA (Sigma) and 0.15% Triton X-100 (Sigma ...
-
bioRxiv - Molecular Biology 2021Quote: ... USA) and benznidazole (N-benzyl-2-nitro-1H-imidazole-1-acetamide) were from Sigma (St. Louis, USA).
-
bioRxiv - Physiology 2023Quote: ... In order to substitute cholesterol in the patch with cholest-4-en-3-one (cholestenone) the bath solution was replaced with 2 mM MBCD solution saturated with cholest-4-en-3-one (Millipore-Sigma, St. Louis, MO).
-
bioRxiv - Cell Biology 2023Quote: – 5-iodo-2’-deoxyuridine (IdU) and 5-Chloro-2′-deoxyuridine (CldU) (Sigma-Aldrich) were dissolved in sterile DMEM at 2.5mM and 200mM respectively and stored at –20°C ...
-
bioRxiv - Neuroscience 2019Quote: ... One day after plating neurons were incubated with 3 uM AraC (Sigma) for two days ...
-
bioRxiv - Neuroscience 2023Quote: ... testosterone-filled (4-androsten-17β-ol-3-one, Sigma Aldrich T-1500) Silastic tubes (2.16 OD x 1.02 ID ...
-
bioRxiv - Biophysics 2022Quote: ... and 2 µM 9-Amino-6-Chloro-2-Methoxyacridine (ACMA, Sigma-Aldrich) to establish a K+ gradient ...
-
bioRxiv - Neuroscience 2020Quote: ... 5 mM 5-Fluro-2’-deoxyuridine (SIGMA U3003). Cells were transfected at DIV17-19 with Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Neuroscience 2021Quote: ... and 5’-fluoro-2’-deoxyuridine (Sigma, 5 μM) were added to the culture medium at days in vitro (DIV ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 mM 5-Fluro-2’-deoxyuridine (SIGMA U3003). Cells were transfected at DIV17-19 with Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: ... differentiated HNEC cultures were incubated for 1h in ALI-differentiation medium supplemented with 5 µg/ml polybrene (Millipore) before infection.
-
bioRxiv - Biophysics 2020Quote: ... Micropatterns were printed for 5 min with specifically designed chrome masks and coated for 1h at 5% CO2 and 37°C with 50μg/mL fibronectin and 20μg/mL Alexa 546–fibrinogen (Sigma) diluted in distilled water ...
-
bioRxiv - Cell Biology 2019Quote: ... 6-Diamidino-2-Phenylindole (DAPI) (Cat# 32670 Sigma) was used to stain the DNA ...
-
bioRxiv - Cell Biology 2020Quote: ... 4’,6-diamidino-2-phenylindole (DAPI; Sigma-Aldrich) was added at a final concentration of 20 ng/μl ...
-
bioRxiv - Developmental Biology 2020Quote: ... 6-dodecanoyl-2-dimethylamino naphthalene (Laurdan; Sigma Aldrich). Briefly ...
-
bioRxiv - Developmental Biology 2020Quote: ... 6-diamidino-2-phenylindole (DAPI; Sigma, D9542-5MG) diluted to 1 mg/mL in water for 5 min ...
-
bioRxiv - Neuroscience 2021Quote: ... 6-diamidino-2-phenylindole (DAPI) (Sigma-Aldrich, D9542), as previously described[8] ...
-
bioRxiv - Genetics 2021Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI; Sigma) for 1 hour at RT ...
-
bioRxiv - Plant Biology 2022Quote: ... DAPI (4′,6-diamidino-2-phenylindole, Sigma-Aldrich) staining used to verify PCD status of xylem cells was performed after fuchsin staining when seedlings were exposed to 50 μg/ml DAPI in 1x PBS (phosphate-buffered saline ...
-
bioRxiv - Developmental Biology 2021Quote: ... 4’,6-Diamidino-2-phenylindole (DAPI, Millipore Sigma) was used at 2.5μg/ml to label nuclei ...
-
bioRxiv - Cancer Biology 2022Quote: ... 4’,6-diamidino-2-phenylindole (DAPI, Sigma-Aldrich) was used as a nuclear stain and was incubated for 10 min ...
-
bioRxiv - Immunology 2022Quote: ... 4’,6-diamidino-2-phenylindole (DAPI; Sigma-Aldrich) was used at 200 ng/ml for nuclei staining ...
-
bioRxiv - Developmental Biology 2019Quote: ... DAPI (4′,6-Diamidine-2′-phenylindole dihydrochloride, SIGMA) staining was performed as in [23] ...
-
bioRxiv - Neuroscience 2019Quote: ... 6-diamidino-2-phenylindole solution (DAPI; Sigma-Aldrich). After washing four times ...
-
bioRxiv - Developmental Biology 2020Quote: ... 4’,6-diamidino-2-phenylindole (DAPI) (Sigma-Aldrich) was used for nuclear staining ...
-
bioRxiv - Systems Biology 2020Quote: ... 4′,6-Diamidino-2-phenylindole (DAPI dye, Sigma) was added as needed to visualize nuclei.