Labshake search
Citations for Millipore Sigma :
301 - 350 of 10000+ citations for 5 1 3 Dioxolan 2 yl 2 3 fluorobenzoyl thiophene since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... and phosphatase inhibitor cocktails 2 and 3 (Sigma-Aldrich). After sonication (0.5 s pulse at 20% amplitude ...
-
bioRxiv - Cancer Biology 2024Quote: ... phosphatase inhibitor 2 and 3 (Sigma Aldrich; P5726and P0044). Samples were standardized for protein concentration using the Pierce BCA protein assay (VWR 23227) ...
-
bioRxiv - Bioengineering 2024Quote: ... 2 mM dithiothreitol (DTT) (3483-12-3, Sigma-Aldrich), and 0.06% Triton X-100 (9036-19-5 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and phosphatase inhibitor cocktails 2 and 3 (Sigma-Aldrich). Cell lysates were calculated to 1 mg/mL followed by incubation with anti-FLAG (rat ...
-
bioRxiv - Cancer Biology 2024Quote: ... and phosphatase inhibitor cocktails 2 and 3 (Sigma-Aldrich) followed by centrifugation at 15,000 rpm for 10 minutes at 4 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5’-GACCAGAGACG TGTAGCAATG-3’, Reverse: 5’-ACAATGCTTTGACGATGCCATA-3’) and ACTB (Forward: 5’-CTGGAACGGT GAAGGTGACA-3’, Reverse: 5’-AAGGGACTTCCTGTAACAATGCA-3’) were ordered from Sigma Aldrich (Missouri, USA). cDNA synthesis was carried out using the QuantiTect Reverse Transcriptase Kit (Qiagen ...
-
bioRxiv - Developmental Biology 2023Quote: ... 2–3 endodermal explants (2PP or 3/4PP endoderm) were combined with 2–3 mesenchymal explants on Nucleopore membrane filters (Millipore) supported by fine meshed metal grids (Goodfellows) ...
-
bioRxiv - Molecular Biology 2021Quote: ... selected for 2-3 weeks with 1 µg/ml of puromycin (Sigma- Aldrich), and surviving cells were fixed with methanol and stained with Giemsa (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2020Quote: ... and 1% phosphatase inhibitor cocktails 2 and 3 (P5726 and P0044, Sigma-Aldrich) added fresh] or RIPA buffer [25 mM Tris pH 7.5 ...
-
bioRxiv - Neuroscience 2020Quote: ... and (3) GluA2 (mouse anti-glutamate receptor 2; Millipore; used at 1:2000). Cochlear pieces were incubated in species appropriate secondary antibodies coupled to Alexa Fluors in the red ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1 mM PMSF and phosphatase inhibitor cocktail 2 and 3 from Sigma Aldrich) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 to 3 million cells were cross-linked using 1% formaldehyde (Sigma, F8775) for 10 minutes at room temperature ...
-
bioRxiv - Biochemistry 2022Quote: ... 2.5mM Na3VO4 and 1% each of phosphatase inhibitor cocktails 2 and 3 (Sigma) and set on ice for 10 minutes prior to sonication ...
-
bioRxiv - Molecular Biology 2023Quote: ... at a ratio of 3:2:1 in HEK 293T cells (Sigma Aldrich) using Lipofectamine 2000 (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1% each phosphatase inhibitor cocktails 2 and 3 (Sigma Cat #P5726 and P0044). Lysates were cleared at 17,000g ...
-
bioRxiv - Neuroscience 2024Quote: ... 1 mM PMSF and phosphatase inhibitor cocktail 2 and 3 (Sigma-Aldrich, Switzerland). The insoluble fraction was then sonicated using a fine probe 15 times at 0.5 sec pulse at an amplitude of 20% ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 1 mM EDTA) supplemented with phosphatase inhibitor cocktail 2 and 3 (Sigma), and protease inhibitor cocktail (cOmplete Protease Inhibitor ...
-
bioRxiv - Cell Biology 2023Quote: ... except the protein sample was concentrated to 4 mg/ml and mixed with 0.005% 3-([3-Cholamidopropyl]dimethylammonio)-2-shydroxy-1-propanesulfonate (CHAPSO; Sigma Aldrich) immediately before vitrification ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2/3 mTeSR1 + 1/3 N2 medium + LSX + PSD Day 6,7: 1/3 mTeSR1 + 2/3 N2 medium + PSD At day 6 cells were detached by Accutase solution (Sigma-Aldrich) and incubated at 37°C for 20 minutes to obtain a single cell suspension ...
-
bioRxiv - Plant Biology 2024Quote: ... and subsequently incubated with rat monoclonal anti-tubulin YL-1/2 antibody (Sigma-Aldrich) at 1:100 dilution ...
-
bioRxiv - Biochemistry 2020Quote: ... The sequence of the biotinylated 2’-deoxyoligonucleotide is 5’ – (Biotin) AAATGGTGCCGAAACCCGGGATCGAACCAGGGT – 3’ (Sigma Aldrich, Munich, Germany)
-
bioRxiv - Microbiology 2022Quote: ... and half of the water was replaced with freshwater (2/3 osmosis (RiOs 5, Merck Millipore) and 1/3 filtered ...
-
bioRxiv - Neuroscience 2024Quote: ... and 3 μg/mL 5-fluoro-2′-deoxyuridine + 7 μg/mL uridine (FRDU, F0503, Sigma-Aldrich). Cultured cells were then kept at 37°C and 5% CO2 in an incubator with culture media changes at 48 hours with supplemented media and NGF and FRDU until further experimentation.
-
bioRxiv - Microbiology 2024Quote: ... 3-(2pyridyl)-5,6-bis(2-(5-furylsulfonic acid))-1,2,4-triazin (Sigma-Aldrich, St Louis, MO, USA) (27) ...
-
bioRxiv - Developmental Biology 2023Quote: ... predicted mature peptide regions of ZmRALF1/2/3/5 genes were cloned into plasmid pET32b (Novagen) with gene specific primers as indicated (Supplemental Table S1) ...
-
bioRxiv - Biochemistry 2022Quote: ... they were cultivated 72 hours in the presence of 2 μM DL-threo-1-phenyl-2-palmitoylamino-3-morpholino-1-propanol (PPMP) (Sigma-Aldrich) to inhibit the synthesis of glucosylceramide-based GSLs 75 and incubated with fluorescent SaroL-1 as previously described ...
-
bioRxiv - Bioengineering 2022Quote: ... with a 3:1 M ratio of 5-norbornene-2-carboxylic acid (mixture of endo and exo isomers; Millipore-Sigma) to HA-TBA repeat units ...
-
bioRxiv - Microbiology 2024Quote: ... Each extract was resuspended in 170 µL of 100% methanol containing isotopically labeled internal standards (5-50 µM of 13C,15N Cell Free Amino Acid Mixture, #767964, Sigma; 1 ug/mL 2-amino-3-bromo-5-methylbenzoic acid, ABMBA, #R435902, Sigma) and centrifuge-filtered (0.22 µm hydrophilic PVDF membrane ...
-
bioRxiv - Biochemistry 2024Quote: ... and 1,2-dioleoyl-sn-glycero-3-phospho-(1’-myo-inositol-4’,5’-bisphosphate) (PI(4,5)P2) in chloroform: methanol (Millipore MX0488): water (20:9:1 ...
-
bioRxiv - Microbiology 2024Quote: ... 2 ug mL-1 N-(6-(isopropylsulfonyl)quinolin-4-yl)benzo[d]thiazol-5-amine hydrochloride (GSK’872) (Sigma-Aldrich # 5303890001) and 2 ug mL-1 Necrosulfanamide (EMD Millipore #480073 ...
-
bioRxiv - Biochemistry 2022Quote: ... The [5′-32P] cytidine 3′,5′-bisphosphate was prepared by incubating 1 mM cytidine 3′-monophosphate (Sigma) with 312.5 pmole [γ-32P] ATP (6000 Ci/mmol ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were cultured in medium supplemented with 2 mM 3-phosphoglycerate (3-PG, Sigma-Aldrich, #P8877) or 2 mM serine (Sigma-Aldrich ...
-
bioRxiv - Immunology 2023Quote: ... Single-cell suspensions (some of which were pooled from tumors harvested from 2-3 mice) were stimulated for 5 h with PMA (5 ng/ml, Sigma) and ionomycin (500 ng/ml ...
-
bioRxiv - Cell Biology 2022Quote: ... Triple Dynamin (Dyn1/2/3) knockout was induced by 1 μM 4-hydroxytamoxifen (Sigma) as previously described44 ...
-
bioRxiv - Systems Biology 2022Quote: ... and phosphatase inhibitor cocktail 2 and 3 (1:100, P5726 and P0044, Sigma-Aldrich). For immunoprecipitation (IP) ...
-
bioRxiv - Immunology 2020Quote: ... and cyclophosphamide (#C7397, 100 mg kg-1 from day −3 to −2; Sigma-Aldrich) intraperitoneally ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1 mM Benzamidine) containing phosphatase inhibitor cocktail 2 and 3 (Sigma, P5726 and P0044). Supernatants containing proteins were collected after centrifugation at the highest speed for 15 minutes at 4°C ...
-
bioRxiv - Physiology 2024Quote: ... 1% phosphatase inhibitor cocktails #2 and #3 (Sigma-Aldrich; Catalog no.: P0044 and P5726), one cOmplete protease inhibitor tablet (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... for 3 h followed by ATP (2 mM, Sigma Aldrich, A6419-5g ...
-
bioRxiv - Cell Biology 2020Quote: ... 1x Phosphatase inhibitor cocktail 2 and 3 from Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2021Quote: ... 1X Phosphatase inhibitor cocktails 2 and 3 (Sigma P5726, P0044), and 1X Protease inhibitor tablets (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... as above and phosphatase inhibitors (Cocktails 2 and 3, Sigma). Proteins were quantified by Bradford assay (Biorad) ...
-
bioRxiv - Biochemistry 2020Quote: Rosetta 2(DE3)pLysS (EMD Millipore Novagen, Cat. # 71403-3)
-
bioRxiv - Biochemistry 2020Quote: Rosetta 2(DE3)pLysS (EMD Millipore Novagen, Cat. # 71403-3)
-
bioRxiv - Neuroscience 2021Quote: ... and 100 μl Phosphatase Inhibitor Cocktail 2 & 3 (Millipore Sigma). Aliquots of lysates were saved for further analyses as total homogenates ...
-
bioRxiv - Neuroscience 2022Quote: ... and phosphatase inhibitor cocktails 2 and 3 (Sigma-Aldrich, Switzerland). Sequential biochemical fractionation of cell extracts was performed as described previously31,34,69 ...
-
bioRxiv - Neuroscience 2022Quote: ... and phosphatase inhibitor cocktail 2 and 3 (Sigma-Aldrich, Switzerland). The cells in suspension were then incubated for 15 min on ice before being lysed mechanically using a Dounce homogenizer (with type B pestle) ...
-
bioRxiv - Neuroscience 2022Quote: ... and phosphatase inhibitor cocktail 2 and 3 (Sigma-Aldrich, Switzerland) and boiled for 10 min as previously described34.
-
bioRxiv - Biophysics 2020Quote: ... supplemented with phosphatase inhibitor cocktails 2 and 3 (Sigma Aldrich) and protease inhibitor (Sigma Aldrich ...
-
bioRxiv - Neuroscience 2020Quote: ... and then 3 μL of 2% Evans Blue (Sigma-Aldrich) was injected into the right later ventricle (AP ...