Labshake search
Citations for Millipore Sigma :
3301 - 3350 of 10000+ citations for 7 Chloro 1H pyrrolo 3 2 b pyridine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2024Quote: ... a 5 µL drop of the formulation was placed on a glass slide that was silanized by liquid phase deposition in a solution of 2% 3-(trimethoxysilyl)propyl methacrylate (cat. #M6514, Sigma-Aldrich, Oakville, Ontario, Canada) prepared in toluene (cat ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and 3 (10 mg/kg) intraperitoneally (i.p.) 30 min prior to injection of zymosan (Sigma-Aldrich; 2 mg/ml in saline, 0.5 ml, i.p.). Mice were sacrificed (by CO2 inhalation ...
-
bioRxiv - Cell Biology 2024Quote: ... Phase separation of lipids from the serum was performed using an organic phase of diisopropyl ether: n-butanol (3:2; Sigma Aldrich, 296856, B7906, respectively). Organic and aqueous phases were allowed to mix at room temperature with continuous stirring in the dark for 1 h ...
-
bioRxiv - Molecular Biology 2024Quote: ... then fully resuspended in 1 mL cold resuspension buffer supplemented with 1% each phosphatase inhibitor cocktails 2 and 3 (Sigma Cat #P5726 and P0044). To lyse the resuspended cells ...
-
bioRxiv - Cell Biology 2022Quote: ... 2-hydroxy-4’-(2- hydroxyethoxy)-2-methylpropiophenone (I2959) (Sigma-Aldrich, USA), a photoinitiatior (0.5% w/v ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2% (v/v) 2-mercaptoethanol and 2 mM PMSF) (Sigma-Aldrich) and homogenize ...
-
bioRxiv - Neuroscience 2020Quote: Animals were anesthetized with avertin (2, 2, 2-Tribromoethanol (Sigma-Aldrich), 125-250 mg/kg ...
-
bioRxiv - Cell Biology 2022Quote: ... 2-Aminoethyl diphenylborinate (2-APB; Sigma), caffeine (Sigma) ...
-
bioRxiv - Neuroscience 2023Quote: ... 2-Deoxyglucose (2-DG, Sigma #D6134) was administered via IP injection at 0.5 mg/g bodyweight ...
-
bioRxiv - Plant Biology 2020Quote: ... and histidine but supplemented with 2.5 mM 3-AT (3-Amino-1,2,4-triazole; Sigma) for 4 days at 28°C.
-
bioRxiv - Genomics 2019Quote: ... with primers 5’ GAGCTGGACGGCGACGTAAACG 3’ and 5’ CGCTTCTCGTTGGGGTCTTTGCT 3’ for amplification (Sigma-Aldrich, Germany). The PCR amplification was as follows ...
-
bioRxiv - Cell Biology 2019Quote: ... washed 3 times in PBS before incubation in PBS supplemented with 3% BSA (Sigma) for 30 min to block non-specific antibody binding ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.12 g (6.25 mmol) of 1-ethyl-3-(3-dimethyllaminopropyl) carbodiimide HCl (Sigma Aldrich) was added to the flask containing 0.98 g (2.7 mmol ...
-
bioRxiv - Plant Biology 2020Quote: ... (±)-3-Hydroxydecanoic acid (3-OH-C10:0) and chitin were obtained from Sigma-Aldrich. All elicitors were dissolved in deionized MilliQ sterile water at the respective stock concentration of 1mM for flg22Pa ...
-
bioRxiv - Neuroscience 2021Quote: ... histone 3 lysine 27 tri-methylation (H3K27me3) and histone 3 antibodies (all from Millipore). Positive bands were detected by chemiluminescent reagents (Thermofisher ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 3-uncoupled (3U) after sequential addition of 3 mM ADP (Sigma-Aldrich A5285), 4 μM oligomycin (Sigma-Aldrich C75351) ...
-
bioRxiv - Immunology 2022Quote: ... containing 0.25% with 3-[(3-cholamidopropyl) dimethylammonio]-1-propanesulfonate (CHAPS) (Sigma, St. Louis, MO) for two minutes at 37°C ...
-
bioRxiv - Immunology 2024Quote: ... 4% 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate hydrate (CHAPS; Sigma-Aldrich, Cat. No. 226947)] ...
-
bioRxiv - Neuroscience 2023Quote: ... Two pulse applications of 3 µM of GSK-3 Inhibitor CHIR99021 (Merck Millipore, 361571) were done on days 13 and 14 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Two pulse applications of 3 μM of GSK-3 Inhibitor CHIR99021 (Merck Millipore, 361571) were done on days 13 and 14 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 98% EDC [1-(3-Dimethylaminopropyl)-3-ethyl carbodiimide hydrochloride] were purchased from Sigma Aldrich. SYBR Safe nucleic acid gel staining dye was obtained from Invitrogen (Fisher Scientific ...
-
bioRxiv - Developmental Biology 2023Quote: ... and (3) 3 hrs at RT in 0.1% Direct Red 23 (212490, Sigma-Aldrich), in PBST ...
-
bioRxiv - Cell Biology 2020Quote: ... Cyanine 3 (NC, Sigma-Aldrich) was used as a control of transfection efficiency.
-
bioRxiv - Developmental Biology 2021Quote: ... 3-bromopyruvate (Sigma Aldrich #16490) or 2-deoxy-D-glucose (CARLROTH #CN96.3 ...
-
bioRxiv - Developmental Biology 2021Quote: The drug 3’-dA (Sigma) was dissolved in M16 medium (Sigma) ...
-
bioRxiv - Developmental Biology 2020Quote: ... blocked with 3% BSA (Sigma) in PBS for 2 h at RT ...
-
bioRxiv - Biochemistry 2022Quote: ... 3×FLAG peptide (F4799, Sigma), Expi29™ expression medium (A1435101 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 10 min (3–18, Sigma) after homogenization by a 5 ml glass-glass douncer (Braun ...
-
bioRxiv - Molecular Biology 2021Quote: ... also containing 3% BSA (Sigma) for 30 minutes at room temperature ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Benzonase (Millipore, 70746-3). The lysates were homogenized by sonication and centrifuged for 1 h ...
-
bioRxiv - Genetics 2019Quote: ... and 3 nM TTNPB (Sigma). Day 8 ...
-
bioRxiv - Cell Biology 2019Quote: ... 3 mM MgCl2 (Sigma-Aldrich), 0.7 % Triton X-100 (Sigma-Aldrich) ...
-
bioRxiv - Physiology 2020Quote: ... 3-isobutyl-1-methylxanthine (Sigma); Glyh-101 (a gift from the Cystic Fibrosis Foundation Therapeutics and Robert Bridges ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 3 mM CHIR99021 (GSK3i, Sigma), and 1000 units/mL LIF (Millipore ...
-
bioRxiv - Developmental Biology 2021Quote: ... 3% BSA (Sigma-Aldrich, A3311), and 0.2% Triton X-100 (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 mM MgCl2 (208337, Sigma) and 2 mM EGTA (E3889 ...
-
bioRxiv - Biochemistry 2021Quote: ... 3 kDa cut-off (Millipore).
-
bioRxiv - Biochemistry 2021Quote: ... 3 kDa cut-off (Millipore).
-
bioRxiv - Biochemistry 2020Quote: ... 3 mM d-Desthibiotin (Sigma) and 0.05% DDM ...
-
bioRxiv - Biochemistry 2020Quote: ... and 3 (Millipore-Sigma # P0044), and 100 μL protease inhibitor cocktail (Millipore-Sigma # P8340 ...
-
bioRxiv - Biochemistry 2020Quote: ... and 3 (Millipore-Sigma # P0044), and 100 μL protease inhibitor cocktail (Millipore-Sigma # P8340 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and benzonase (Millipore, 71205-3). Protein concentration was estimated using BCA assay ...
-
bioRxiv - Cell Biology 2021Quote: ... blocked with 3% BSA (Sigma) in PBS for 3 h ...
-
bioRxiv - Biophysics 2020Quote: ... 3 μM Chir99021 (Sigma-Aldrich), 1 μM PD0325901 (Sigma-Aldrich).
-
bioRxiv - Plant Biology 2021Quote: ... 3% Igepal (Sigma, #CA-630) in MTSB for 1 h ...
-
bioRxiv - Biochemistry 2021Quote: ... phosphoenolpyruvate (3 mM; Sigma-Aldrich), Tris-HCl (100 mM ...
-
bioRxiv - Microbiology 2020Quote: ... 3 µM dexamethasone (Sigma-Aldrich), 10 µM DAPT (Stem Cell Technologies) ...
-
bioRxiv - Systems Biology 2020Quote: ... 3 mM trolox (Sigma 238813), 0.8% D-glucose (Sigma G7528) ...
-
bioRxiv - Systems Biology 2021Quote: ... 3 mM Trolox (Sigma 238813), 10% D-glucose (Sigma G7528) ...
-
bioRxiv - Neuroscience 2020Quote: ... Biocytin hydrochloride (.3%; Sigma-Aldrich) was added to the pipette for use in post fixation (4% paraformaldehyde ...