Labshake search
Citations for Millipore Sigma :
3151 - 3200 of 10000+ citations for Contactin Associated Protein Like 3 CNTNAP3 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... The supernatant was collected and total protein content determined with a BCA Protein Assay (Sigma, Poole, UK). A total of 20μg protein extract for each sample was separated by electrophoresis on Nu-PAGE™ 4-12% ...
-
bioRxiv - Cell Biology 2022Quote: ... Supernatant was retrieved and protein concentration was measured by BCA protein assay (Novagen, (Smith et al. 1985). Protein concentrations were adjusted in all the samples to 800 µg/ml ...
-
bioRxiv - Biochemistry 2022Quote: Protein—protein interactions were studied using a Duolink In Situ Orange Starter Kit Mouse/Rabbit (Sigma, DUO92102) following the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2023Quote: Proteins were extracted from the conditioned medium using the protein precipitation kit (#2100, Millipore Sigma, Burlington, MA) following the manufacturer’s specifications ...
-
bioRxiv - Cell Biology 2022Quote: Protein-protein interactions were studied using a Duolink In Situ Orange Starter Kit Mouse/Rabbit (Sigma DUO92102) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... or cellulose solution in N-hydroxysuccinimide (NHS; Aldrich; 100 mM) and 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC, Sigma; 100 mM, 90 min, RT)44 ...
-
bioRxiv - Microbiology 2019Quote: ... 5α-androstan-17β-ol-3-one (=17β-hydroxyandrostan-3-one) and 3aα-H-4α(3’-propanoate)-7aβ-methylhexahydro-1,5-indanedione (HIP) were obtained from Sigma-Aldrich (St. Louis, MO, USA). 5α-androstan-3β,17β-diol (=3β,17β-dihydroxyandrostane ...
-
bioRxiv - Immunology 2021Quote: The livers of freshly-sacrificed mice were perfused retrogradely via the IVC(3) with 3 ml of PBS and then 10 ml of 2% paraformaldehyde (Sigma, catalogue# 30525-89-4) in PBS ...
-
bioRxiv - Immunology 2020Quote: ... injection of 106 hemocytes from late third instar larvae of the lethal(3)malignant blood neoplasm [l(3)mbn1] mutant larvae in Drosophila Ringer’s solution (Sigma-Aldrich, St. Louis, MI, USA). Booster injections were given 4 ...
-
bioRxiv - Biophysics 2023Quote: ... The surface of the coverslips were then coated with a solution of 3% (v/v) (3-Aminopropyl) triethoxysilane (APTES, Sigma-Aldrich, St. Louis, MO) in ethanol for 20 min at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... strains containing a degron tag were arrested at 30 °C for 3 hours (total) and then treated with 250 μM 3-indole acetic acid (Sigma-Alrich, St. Louis, MO) for 30 minutes before harvesting ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: When the tumor sizes reached to 80 mm3 animals were treated with a PFKFB3 inhibitor 3-(3-pyridinyl)-1-(4-pyridinyl)-2-propen-1-one) (3PO) (Sigma-Aldrich, Merck, Overijse, Belgium). The animals received intraperitoneal (i.p. ...
-
bioRxiv - Biophysics 2023Quote: 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC) and 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP) dry powders were purchased from Sigma Aldrich (St. Louis, MO, USA). Different amounts of DOPC and DOTAP were used to tune the surface charge of the employed liposomes ...
-
bioRxiv - Biophysics 2023Quote: ... the quench buffer also included 3 μL of 0.8% GDN and 3 μL of 300 mg/ml aqueous suspension of ZrO2-coated silica (Sigma-Aldrich, reference no. 55261-U). The resulting mixture was incubated on ice for 1 min to remove lipids and solubilize prestin in GDN before being filtered through a cellulose acetate spin cup (Thermo Pierce ...
-
bioRxiv - Plant Biology 2020Quote: ... 150 µM 3′,5′-Dimethoxy-4′-hydroxyacetophenone (acetosyringone; SIGMA, USA) at a 23.7×108 cfu/ml (OD600=0.75 ...
-
bioRxiv - Neuroscience 2021Quote: ... for 3 h followed by ATP (2 mM, Sigma Aldrich, A6419-5g ...
-
bioRxiv - Cell Biology 2019Quote: ... rabbit polyclonal anti-PCSK1 (PC1/3) (1:1000, Sigma, #SAB1100415), rabbit polyclonal anti-TSSC1/EIPR1 (1:1000 ...
-
bioRxiv - Cell Biology 2020Quote: ... supplemented with 200 μM 3-isobutyl-1-methylxanthine (IBMX; Sigma), and their cumulus cells were removed by gentle pipetting ...
-
bioRxiv - Cell Biology 2020Quote: ... 250 μM 3-isobutyl-1-methylxanthine (IBMX, Sigma-Aldrich # I5879), 1 μM rosiglitazone (Cayman Chemical # 71742) ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were blocked and simultaneously permeabilized with 3% BSA (SIGMA) and 0.2% Triton X-100 (SIGMA ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were subsequently blocked and permeabilized with 3% BSA (SIGMA) and 0.2 w/v % Saponin (Millipore ...
-
bioRxiv - Cell Biology 2020Quote: ... or 3 µg/cm2 poly-L-lysine (Sigma-Aldrich, P6407) overnight at 4°C ...
-
bioRxiv - Cell Biology 2020Quote: ... 1x Phosphatase inhibitor cocktail 2 and 3 from Sigma-Aldrich) ...
-
bioRxiv - Immunology 2021Quote: ... and then blocked with 3% (w/v) BSA (Sigma-Aldrich) and 0.05% (v/v ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3-15 µM MG132 (Z-Leu-Leu-Leu-al, Sigma) was added to the media for the indicated hours prior to cell lysis/fixation ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and 30 μL D2O with 3%TPS (Sigma Aldrich, 450510) and transferred in a standard 5 mm NMR tube (Wilmad-LabGlass ...
-
bioRxiv - Neuroscience 2022Quote: ... propyl acetate and 3-methyl-2-buten-1-ol (Sigma). Odorants were selected based on previous work using this task (Gu & Li ...
-
bioRxiv - Biophysics 2022Quote: ... 250 μM 3-isobutyl-1-me-thylxantine IBMX (Sigma-Aldrich), 100nM cortisol (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... 1X Phosphatase inhibitor cocktails 2 and 3 (Sigma P5726, P0044), and 1X Protease inhibitor tablets (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... and dispase-II (3 mg/mL, Cat# D4693, Sigma-Aldrich) for 60 min at 37 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... anti-Partitioning-defective 3 (Par3) (Sigma, 07-330, 1:1000), anti-Parvin (Cell signaling ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 × 5 minutes each and were mounted using Fluorosave (Millipore) before imaging ...
-
bioRxiv - Molecular Biology 2021Quote: ... samples were incubated for 3 days in JB-4 (Sigma)/Eosin (Sigma)/Acridine orange (Sigma ...
-
bioRxiv - Molecular Biology 2021Quote: ... DL-Serine Hydroxymate (SHX, Sigma CAS Number 55779-32-3), an inhibitor of seryl-tRNA synthetase which triggers the stringent response and prevents new rounds of replication ...
-
bioRxiv - Bioengineering 2022Quote: ... 121 mg of N-(3-Dimethylaminopropyl)-N’-ethylcarbodiimide ( EDC) (Sigma) and 28 mg of RGD peptide ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3:1 mixture of random hexamers/OligodT (Sigma-Aldrich), following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... 3 μL of 1 mg/mL RNase A (Sigma R6148) and 3 μL of 20 mg/mL Proteinase K (NEB EO0491 ...
-
bioRxiv - Immunology 2021Quote: ... supplemented with 3% murine plasma and 10 mM HEPES (Sigma) and left to settle for 45 minutes in the incubator at 37°C and 5% CO2 ...
-
bioRxiv - Immunology 2021Quote: ... siRNA-TDP-43 D: 5’-GAAACAAUCAAGGUAGUAA[dT][dT]-3’ (Sigma)4 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Phostphatase Inhibitor Cocktail 3 (Sigma-Aldrich; St. Louis, MO, USA) 1x TBS ...
-
bioRxiv - Molecular Biology 2021Quote: ... Phostphatase Inhibitor Cocktail 3 (Sigma-Aldrich; St. Louis, MO, USA) 1x TBS ...
-
bioRxiv - Neuroscience 2019Quote: ... the VDAC1 shRNA sequence 3 ACCAGGTATCAAACTGACGTTCT (Sigma-Aldrich, Ref. #TRCN0000012392) or the shRNA control (dsRed2 ...
-
bioRxiv - Developmental Biology 2019Quote: ... and Phosphatase Inhibitor Cocktail no.2 and no.3 (Sigma). Following manufactures recommendations ...
-
bioRxiv - Physiology 2019Quote: ... and 100 μM 3-isobutyl-1-methylxanthine (IBMX, Sigma-Aldrich) was added to elicit a maximal cAMP response ...
-
bioRxiv - Immunology 2019Quote: ... and incubated in blocking buffer (3% BSA (#A7906, Sigma, USA) in PBS supplemented with 0.1% Triton X-100 (#9002-93-1 ...
-
bioRxiv - Bioengineering 2019Quote: ... 2 mM of HCL (Millipore Sigma, cat no. HX0603-3), and 0.5 mM of iron (II ...
-
bioRxiv - Immunology 2019Quote: The macrophages were activated by 3 μg/mL LPS (Sigma) and 100 pmol IFN-γ for 6 hrs ...
-
bioRxiv - Physiology 2020Quote: ... containing 3% (w:v) bovine serum albumin (BSA) (Sigma Aldrich, Australia), 1 mg/ml Type 2 Collagenase (Sigma Aldrich ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 100 µM acetosyringone (3′,5′-dimethoxy-4′-hydroxyacetophenone, Sigma D134406), and incubated for 6h at 28°C at 150 rpm.
-
bioRxiv - Immunology 2019Quote: ... followed by blocking of endogenous peroxidase with 3% H2O2 (Sigma H-1009 ...