Labshake search
Citations for Millipore Sigma :
3101 - 3150 of 4383 citations for MOA SAP Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: Cells were lysed with 0.5% SDS in EB buffer and bisulphite treated with the Imprint DNA Modification kit (Sigma). The resulting DNA was purified using columns and reagents from the EZ DNA Methylation Direct kit (Zymo Research) ...
-
bioRxiv - Cell Biology 2019Quote: ... The membrane was blocked for 1 hour in 1% BSA/TBS-T and probed with antibodies provided in the kit according to the manufacturer’s instructions (Millipore).
-
bioRxiv - Molecular Biology 2021Quote: ... 1/1000) antibodies for 2 h at 37 °C in antibody diluent solution (Duolink in situ kit, Sigma-Aldrich). The cells were then labeled with the PLA antimouse PLUS probe (DUO92001 ...
-
bioRxiv - Molecular Biology 2021Quote: RNA extraction with on-column DNAse treatment were done using the GenElute Mammalian Total RNA Miniprep Kit (Sigma-Aldrich) according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2020Quote: Total RNA was isolated from the aboveground tissues of seedlings using the Spectrum Plant RNA Isolation Kit (Sigma-Aldrich). The RNA was treated with RNase-free RQ1 DNase (Promega) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Ligation and amplification steps of the PLA were performed using the Duolink in situ Detection Reagents Orange kit (Sigma) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... and performed western blotting analysis.Western blotting: Protein concentration of lysates was determined with Bicinchoninic Acid Kit (#BCA1, Sigma Aldrich). Equal amount of proteins was loaded on the poly-acrylamide gels ...
-
bioRxiv - Neuroscience 2021Quote: ... collected by centrifugation and cell viability was determined by flow cytometry with Muse® Count &Viability Assay Kit (Millipore), following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: Yolk sacs were dissected from embryos and used for DNA extraction with the Red Extract-N-Amp kit (Sigma). Usp9x status was assessed by PCR using Phire Green Hot Start II PCR Master Mix (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2020Quote: ... PLA and EdU counterstaining were performed according to the manufacturer’s instructions using the Duolink In Situ Red kit (Sigma) and goat anti-mouse Alexa Fluor 488 antibody.
-
bioRxiv - Evolutionary Biology 2022Quote: ... We extracted DNA from our cultured microbiomes with GenElute Bacterial Genomic DNA kits (Millipore-Sigma, St. Louis, MO, USA). We sent ≈10 ng of DNA from each extraction to Genome Qúebec (McGill University ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... We extracted DNA from our cultured microbiomes with GenElute Bacterial Genomic DNA kits (Millipore-Sigma, St. Louis, MO, USA). We sent ≈10 ng of DNA from each extraction to Genome Qúebec (McGill University ...
-
bioRxiv - Molecular Biology 2019Quote: Whole-tissue sample lysates were batch processed for glycogen determination using commercially-available fluorometric kits (catalog #: MAK016; Millipore Sigma) as per the manufacturer’s instructions ...
-
bioRxiv - Physiology 2020Quote: ... and 30 min of working mode and LDH levels were measured using the TOX 7 assay kit (Sigma-Aldrich). Duplicate 75 μL aliquots were assayed according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... gDNA for illumina sequencing of the eleven other isolates was extracted using a Genelute Plant DNA Miniprep Kit (Sigma) using the manufacturers protocol with the following modifications ...
-
bioRxiv - Evolutionary Biology 2020Quote: Total RNA was extracted from flower buds or leaves with the Spectrum Plant Total RNA kit (Sigma, Inc., USA), following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: ... The protein band was excised from gel and digested with trypsin using trypsin profile IGD kit (Sigma-Aldrich, India). The peptides obtained after trypsin digestion were analyzed by Matrix-assisted Laser Desorption Ionization-Time of Flight (MALDI-TOF ...
-
bioRxiv - Plant Biology 2020Quote: ... France) and 500 μl of lysis/2-Mercaptoethanol solution of the SpectrumTM Plant Total μ RNA Kit (Sigma-Aldrich, St ...
-
bioRxiv - Physiology 2019Quote: ... HDL-cholesterol and LDL-cholesterol concentration were evaluated enzymatically using assay kits (Sigma Chemical Co, St Louis, MO, USA). VLDL-cholesterol was calculated as triglycerides and LDL-cholesterol was calculated by the equation ...
-
bioRxiv - Cell Biology 2019Quote: ... Cells were subsequently fixed in 8% formaldehyde and stained using the Alkaline-Phosphatase kit (86R 1KT, Sigma-Aldrich, Germany) following the manufacturer’s protocol ...
-
bioRxiv - Genomics 2019Quote: ... cells were collected at day 8 and RNA was extracted using GenElute Mammalian Total RNA MiniPrep Kit (Sigma #RTN350). cDNA was synthesized using oligodT primers using SuperScript II Reverse Transcriptase (Thermo Fisher Scientific #18064014) ...
-
bioRxiv - Microbiology 2019Quote: ... Quantitative real-time PCR using cDNA was performed using KAPA SYBR fast qPCR master mix kit (Sigma Aldrich, USA) and Applied Biosystems StepOne Plus Real-Time PCR system ...
-
bioRxiv - Microbiology 2019Quote: ... Size of the PCR products was verified by gel electrophoresis and purified using an Amicon Ultra 0.5 ml kit (Millipore).
-
bioRxiv - Genetics 2020Quote: Blood ammonia levels were measured by ammonia colorimetric assay kits (BioVision Incorporated; Cat# K370-100 or Sigma; Cat#AA0100) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: In vitro PI3 Kinase activity measurements were performed with the PI3K Kinase Activity/Inhibitor assay kit following manufacturer’s instructions (Merck Millipore). Briefly ...
-
bioRxiv - Cell Biology 2021Quote: ... PLA was performed according to the manufacturer’s recommendation (Duolink™ In Situ Red Starter Kit Mouse/Rabbit, Sigma-Aldrich). Primary antibodies against GFP (ab13970 ...
-
bioRxiv - Neuroscience 2020Quote: Proteasome activity in mice brain tissue was analysed following the 20S Proteasome activity assay kit protocol by Millipore (APT280). The assay detects the fluorophore 7-Amino-4-methylcoumarin (AMC ...
-
bioRxiv - Cancer Biology 2020Quote: ... an intracellular flow cytometry protocol was modified from the FlowCellect™ Autophagy LC3 Antibody-based Assay Kit (Millipore, FCCH100171). After RBC lysis ...
-
bioRxiv - Neuroscience 2020Quote: PP2A activity was measured by using immunoprecipitation phosphatase assay kit according to the manufacturer’s instructions (Catalog # 17-313, Millipore). Statistical differences were analyzed using post hoc test with Bonferroni’s correction following one-way ANOVA ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... using ortho-nitrophényl-β-galactoside as substrate (β-Galactosidase Reporter Gene Activity Detection Kit, Sigma St Louis MI USA).
-
bioRxiv - Neuroscience 2019Quote: ... Total protein staining solution (REVERT Total Protein Stain kit, LI-COR Inc., # 926-11010; Pyronin Y (Sigma-Aldrich # P9172)
-
bioRxiv - Cell Biology 2021Quote: Senescence-associated β-galactosidase (SA-β-gal) activity was determined with the Senescence Cells Histochemical Staining Kit (Sigma-Aldrich). Six representative images were captured on a TS100 inverted light microscope (Nikon ...
-
bioRxiv - Cancer Biology 2021Quote: ... and GM-CSF levels were quantified using ELISA kits pre-coated with indicated capture antibodies per manufacturer’s instructions (Sigma). IL-6 levels were preliminarily detected using a Q-Plex Human cytokine screen (16-plex ...
-
bioRxiv - Bioengineering 2021Quote: A phosphate assay was performed according to the manufacturer’s instruction (Malachite Green Phosphate Assay Kit, Sigma-Aldrich, The Netherlands). Briefly ...
-
bioRxiv - Cell Biology 2021Quote: ... analyzed with the Duolink In Situ Red Mouse/Rabbit kit assay according to the manufacturer’s instructions (DUO94001, Sigma-Aldrich). In brief ...
-
bioRxiv - Plant Biology 2021Quote: Total RNA was extracted from apple leaves with the Spectrum Plant Total RNA Kit (Sigma-Aldrich, St. Louis, MO). Two micrograms of total RNA were treated with DNAse (Ambion ...
-
bioRxiv - Plant Biology 2021Quote: Genomic DNA was extracted from leaves using the GenElute Plant Genomic DNA Miniprep Kit (Sigma-Aldrich, St. Louis, USA). The integrity of the DNA was verified by electrophoresis on a 1% agarose gel stained with ethidium bromide ...
-
bioRxiv - Microbiology 2021Quote: ... Plasmid DNA was isolated in an endotoxin-free manner (GenElute™ HP Endotoxin-Free Plasmid Maxiprep Kit; Sigma-Aldrich) and concentrated using paramagnetic beads (HighPrep PCR Clean Up System ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... total RNAs were isolated from young buds or leaves using the Spectrum™ Plant Total RNA Kit (SIGMA-ALDRICH). Approximately 5 ug of total RNAs were used to construct cDNA libraries (NEBNext Ultra Directional RNA Library Prep Kit for Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... The pellets were then resuspended in 300µl of cold L-Amino Acid Assay buffer according to the manufacturer instructions (L-Amino Acid Quantification kit, Sigma) and lysates were then centrifuged at 13,000 rpm for 10min at 4°C to remove insoluble material ...
-
bioRxiv - Microbiology 2021Quote: ... Metabolite peaks were confirmed using the mass spectrometry metabolite library kit MSMLS-1EA (Sigma Aldrich supplied by IROA Technologies).
-
bioRxiv - Immunology 2020Quote: ... PCRs for genotyping of bacterial colonies after transformation were performed using the KAPA2G Fast ReadyMix kit (Sigma Aldrich, #KK5102) with custom designed primers and the following cycling conditions ...
-
bioRxiv - Microbiology 2020Quote: Bacterial DNA was isolated and purified with the GenEluteTM Bacterial Genomic DNA kit (Sigma-Aldrich, St. Louis, Missouri, USA). PCR was used for the identification of six virulence factor genes (fliL ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay was performed according to manufacturer’s instructions using ApopTag Fluorescein In Situ Apoptosis Detection Kit (Millipore).
-
bioRxiv - Plant Biology 2021Quote: RNA from frozen ground stem samples was extracted using a Plant Total RNA extraction kit (Sigma, St Louis, MO) with modifications to the kit protocol ...
-
bioRxiv - Microbiology 2020Quote: ... The plasmid was purified using a Qiagen Maxi kit and resuspended in CytoMix (25 mM HEPES, pH 7.6, 2 mM EGTA (Sigma), 5 mM MgCl2 (Fisher Scientific) ...
-
bioRxiv - Microbiology 2019Quote: ... The glycogen content was measured with a fluorometric method as described in the MAK016 assay kit instructions (Sigma-Aldrich).
-
bioRxiv - Molecular Biology 2021Quote: RNA immunoprecipitation assay was carried out according to the Magna RIP RNA-Binding Protein Immunoprecipitation Kit manufacturer’s instruction (Millipore). Briefly ...
-
bioRxiv - Microbiology 2020Quote: ... Quantitative real-time PRC using cDNA was performed using KAPA SYBR fast qPCR master mix kit (Sigma Aldrich, USA) and Applied Biosystems StepOne Plus Real-Time PCR system ...
-
bioRxiv - Microbiology 2020Quote: ... using First strand cDNA synthesis kit (Fermentas K1612) qPCR was performed using Fast Start Universal Master mix (ROX) (Sigma) using exon spanning primers:-IL17A_Fp TGGAATCTCCACCGCAATGA ...