Labshake search
Citations for Millipore Sigma :
3101 - 3150 of 7624 citations for 3 Methoxy Acetaminophen d3 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: ... by constant pressure and in the presence of 1 mM 3-AT (Sigma). The injected zygotes were cultured at 16C for Sp ...
-
bioRxiv - Molecular Biology 2022Quote: ... Protein was concentrated using a 3 kDa cutoff spin concentrator (Millipore Sigma UFC9003) to a volume of 2 mL ...
-
bioRxiv - Developmental Biology 2022Quote: ... and incubated in secondary antibodies (Supplemental Table 3) and DAPI (10g/ml, Sigma,) diluted in 10% NDS in 0.1% Triton-PBS for 90 minutes at r.t ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 3 ml of selective EZ containing 0.85 g/l Pluronic F-127 (Sigma) were inoculated with the overnight preculture in a 1:100 ratio and grown for 3-4 h at 37° C ...
-
bioRxiv - Synthetic Biology 2020Quote: ... followed by plating on SP4 agar containing 3 µg/mL of puromycin (Sigma). Colonies appeared after 3 to 4 days at 37 °C.
-
bioRxiv - Evolutionary Biology 2020Quote: ... cells were treated with 3% H2O2 (v/v in 1xPBS; Millipore Sigma, Canada) to eliminate endogenous peroxidase activity and dehydrated overnight in 70% ethanol ...
-
bioRxiv - Developmental Biology 2020Quote: ... the cells were washed 3 times and maintained in XF-DMEM (Sigma-Aldrich) supplemented with 1 mM sodium pyruvate and 17.5 mM glucose ...
-
bioRxiv - Pathology 2020Quote: ... followed by a permeabilization step with 3% Triton™ X-100 (Sigma Aldrich) for an additional 5 min in the blocking buffer ...
-
bioRxiv - Microbiology 2020Quote: The magnetic extraction set-up consisted of three 3 mL cuvettes (Sigma Aldrich) and a neodymium magnet (60×10×3 mm ...
-
bioRxiv - Neuroscience 2020Quote: ... 1.2 μL of MgCl2 (25 mM, Sigma-Aldrich, #M8266; CAS 7786-30-3), 2 μL of genomic DNA ...
-
bioRxiv - Microbiology 2021Quote: ... 3 dpf MD zebrafish were soaked in 25 μg/mL lipoteichoic acid (Sigma) or 25 μg/mL peptidoglycan (Sigma).
-
bioRxiv - Physiology 2020Quote: ... blocked with PBST containing 3 % normal goat serum (blockPBST; Sigma-Aldrich, MO, USA) for 1 h ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Aggregates were incubated with primary antibodies in blocking buffer (3% BSA (Sigma, A9647) and 0.3% Triton X-100 in PBS ...
-
bioRxiv - Neuroscience 2021Quote: ... and 1µl of each primer (10µm, 5’: FAATGGCAGAGTGGGGTTGGG, 3’: CGGCAAACGGACAGAAGCATT, Sigma-Aldrich, USA).
-
bioRxiv - Biophysics 2020Quote: ... the larvae were anesthetized with tricaine (3-amino benzoic acidethylester, Sigma Aldrich, MO) and immobilized in 1% low-melting-point agarose inside FEP (Fluorinated Ethylene Propylene ...
-
bioRxiv - Microbiology 2020Quote: ... The grids were washed 3 times with 1% bovine serum albumin (BSA; Sigma) in DPBS and blocked in 0.1% gelatin (Aurion ...
-
bioRxiv - Microbiology 2021Quote: ... we pumped ∼3-6 liters of fluid through 0.22 µm Sterivex filters (Millipore) on the seafloor ...
-
bioRxiv - Bioengineering 2021Quote: ... 48.42 mg of N-(3-Dimethylaminopropyl)-N’-ehtylcarbodiimide hydrochloride (EDC-HCl) (Sigma-Aldrich) were added to the solution along with 27.40 mg of N-hydroxy-sulfosuccinimide (sulfo-NHS ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Membranes were washed 3×5 min with 0.1% Tween® 20 (Sigma-Aldrich) in TBS before a 1 hour incubation with a 1:5,000 dilution of sheep anti-mouse IgG horseradish perodixase secondary antibody (GE Healthcare ...
-
bioRxiv - Microbiology 2020Quote: ... and 3 ml of fresh medium containing 0.75% carboxy-methyl-cellulose (Sigma-Aldrich) was added ...
-
bioRxiv - Bioengineering 2021Quote: ... Cultures were maintained in the presence of neurotrophin-3 (50ng/ml, Sigma-Aldrich) and brain derived neurotrophic factor (50 ng/ml ...
-
bioRxiv - Microbiology 2020Quote: ... and incubated with 500 µL of 2% 3-aminopropyltriethoxysilane (Sigma; 919-30-2) in 95% ethanol for 5 min ...
-
bioRxiv - Cell Biology 2021Quote: ... the cells were individually embedded in 3% agarose (Sigma Aldrich, St. Louis, USA), dehydrated and embedded in epoxy resin (44611-4 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 10 mL of 1% alcian blue in 3% acetic acid (Sigma-Aldrich, B8438), and 10 mL water was prepared ...
-
bioRxiv - Developmental Biology 2020Quote: T7-promoter sequence- and 3’ overhang-containing DNA oligos were synthesized (Sigma-Aldrich), annealed to a common tracer oligo (AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC) ...
-
bioRxiv - Developmental Biology 2020Quote: ... The completed plasmid was transformed into Rosetta BL21 cells (Millipore Sigma, 70954-3). A starter culture of 5 ml of Rosetta BL21 cells containing the completed plasmid were grown overnight at 37°C in LB with Kanamycin ...
-
bioRxiv - Biochemistry 2020Quote: ... then visualized using 400 μL 8 mg/mL 3-amino-9-ethylcarbazole (Sigma) in 10 mL 50 mM sodium acetate (Fisher ...
-
bioRxiv - Neuroscience 2021Quote: ... permeabilised for 3 minutes at room temperature with 0.1 % Triton-X-100 (Sigma) in DPBS ...
-
bioRxiv - Cell Biology 2021Quote: ... 3% (w/w) H2O2 stock (Sigma-Aldrich, Saint Louis, MO, Catalog #323381-25ML) was stored in 100 μL aliquots at −20°C.
-
bioRxiv - Cancer Biology 2021Quote: ... concentrated with an Amicon Ultra Centrifugal Filter Units (3 kDa cutoff, Millipore UFC900324) and buffer exchanged with 50 mM Ammonium bicarbonate (Sigma A6141) ...
-
bioRxiv - Cell Biology 2020Quote: ... This basal medium was supplemented with 2i-LIF (3 µM CHIR99021, Sigma-Aldrich, cat ...
-
bioRxiv - Biochemistry 2021Quote: ... Flow cells were regenerated using 3 M GuHCl (Sigma Aldrich, Saint Louis USA). Sensorgrams were analysed ...
-
bioRxiv - Biochemistry 2021Quote: ... Serum free medium was concentrated using 3 kDa cut-off filters (Sigma-Aldrich). Next ...
-
bioRxiv - Biochemistry 2021Quote: ... pre-incubated for 3-7 h with rabbit anti-FLAG antibody (Sigma-Aldrich) at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... Later the harvested brains were incubated in 3 mL of 99.5% formamide (Sigma) for 48 hours at 37°C ...
-
bioRxiv - Cell Biology 2021Quote: ... media was spin-concentrated using a 3 kDa MWCO centrifugal unit (Millipore-Sigma) and the concentrated conditioned media was analyzed by Luminex.
-
bioRxiv - Cell Biology 2021Quote: ... media was spin-concentrated using a 3 kDa MWCO centrifugal unit (Millipore-Sigma) and the concentrated conditioned media was analyzed by Luminex.
-
bioRxiv - Immunology 2021Quote: ... mtDNA depletion was induced by 100 μM 2′,3′ dideoxycytidine (ddC, Sigma-Aldrich) in medium supplemented with uridine and sodium pyruvate ...
-
bioRxiv - Developmental Biology 2021Quote: ... Differentiation media was supplemented with 2ng/ml BMP4 and 3 µmol Thiazovivin (Millipore). embryoid bodies were cultured in 6cm dishes (USA Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... Cells were blocked for 1 hour at room temperature (3% BSA (Sigma, A3803) in D-PBS) ...
-
bioRxiv - Pathology 2021Quote: ... with the addition of blocking endogenous peroxidase activity with 3% H2O2 (Sigma Aldrich) in ddH2O after epitope retrieval ...
-
bioRxiv - Biochemistry 2021Quote: ... The samples were then washed using water and 3-kDa filters (Millipore Sigma) to remove any guanidine hydrochloride ...
-
bioRxiv - Developmental Biology 2020Quote: ... Embryos were stained during 3 hours with 0.5% w/v Victoria Blue (Sigma) in acid alcohol and after staining embryos were washed in acid alcohol until the embryos were white ...
-
bioRxiv - Developmental Biology 2021Quote: ... Embryos were mounted on the 3% Methyl cellulose (Sigma Aldrich, cat no. M0512) and imaged on an Axioplan Microscope (Zeiss ...
-
bioRxiv - Immunology 2020Quote: ... 6-diamidino-2-phenylindole (DAPI; Sigma, 28718-90-3, St Louis, MO, USA). The results were recorded using Zeiss LSM780 confocal system (Zeiss ...
-
bioRxiv - Biophysics 2020Quote: ... MTT (3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide, p# M5655, Sigma-Aldrich) was dissolved in Phosphate Buffer Solution (PBS ...
-
bioRxiv - Cell Biology 2020Quote: ... cultures were supplemented with auxin (Indole-3-acetic acid sodium salt, Sigma I5948) to final concentrations of 500 µM ...
-
bioRxiv - Genomics 2021Quote: Total RNA was extracted from 3×106 HeLa cells using TRIzol (Sigma, T9424). Prior to submission for high-throughput sequencing ...
-
bioRxiv - Microbiology 2021Quote: ... we fixed 100mL of mid-exponential LSUCC0096 culture with 3% glutaraldehyde (Sigma Aldrich) and stored at 4°C overnight ...
-
bioRxiv - Molecular Biology 2021Quote: ... Depletions were induced by 3 days exposure to 2.5 μg/ml doxycycline (Sigma) as described (19) ...