Labshake search
Citations for Millipore Sigma :
3001 - 3050 of 10000+ citations for Tetratricopeptide Repeat Protein 5 TTC5 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... Slides were stained with 5% Giemsa (Sigma), rinsed with distilled water ...
-
bioRxiv - Biochemistry 2021Quote: ... 5% glycerol) supplemented with DNaseI (Sigma Aldrich) and cOmplete mini EDTA-free protease inhibitor cocktail (Roche ...
-
bioRxiv - Bioengineering 2021Quote: ... 5 mg/ml MTT solution (Sigma, Germany) was added to each well ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 nM Dexamethasone (100 mM; Sigma-AldrichD1756) 5 μL ...
-
bioRxiv - Bioengineering 2020Quote: ... supplemented with 5% L-glutamine (200nM, Sigma) and penicillin/streptomycin (0.1 mg/ml ...
-
bioRxiv - Cancer Biology 2022Quote: ... containing 5% BSA (Millipore Sigma, Burlington, MA) and a 1:10,000 dilution of plasmocin (InvivoGen ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5 mg/ml insulin (I2643, Sigma-Aldrich), 24 mg/ml adenine (A2786 ...
-
bioRxiv - Immunology 2022Quote: ... supplemented with 5% L-Glutamine (Sigma-Aldrich), 10% FCS (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... tamoxifen (Sigma, 50mg/kg, 5 consecutive doses) was given to these mice when they were ~15 days old through i.p ...
-
bioRxiv - Microbiology 2022Quote: ... supplemented with 5% FBS (F1051, Millipore Sigma), 1× non-essential amino acids (M7145 ...
-
bioRxiv - Molecular Biology 2020Quote: ... N-acetylcysteine (5 mM, Sigma-Aldrich®), MitoTempo (100 μM ...
-
bioRxiv - Neuroscience 2022Quote: ... supplemented with 5 μM Y-27632 (Sigma). Cell medium was changed daily till day 5 ...
-
bioRxiv - Genetics 2022Quote: ... 5 µM dexamethasone (SIGMA, cat. no. D1756), 10 ng/ml EGF (SIGMA ...
-
bioRxiv - Immunology 2022Quote: ... and 5 μl/ml DNase I (Sigma) for 30 min at 37°C with gentle shaking ...
-
bioRxiv - Immunology 2022Quote: ... Adenosine 5’-triphosphate (ATP) from Sigma-Aldrich and Clostridium difficile toxin B (TcdB ...
-
bioRxiv - Cell Biology 2022Quote: ... and laminin (5 μg/ml, #L2020, Sigma) and grown as described above ...
-
bioRxiv - Cell Biology 2022Quote: ... and laminin (5 μg/ml, #L2020, Sigma) and cultured with a medium containing 1/5 of human EGF and human FGF-basic ...
-
bioRxiv - Microbiology 2022Quote: ... 5 mg/mL yeast extract (Sigma-Aldrich), 11.48 mM dibasic potassium phosphate (Avantor Performance Materials) ...
-
bioRxiv - Cancer Biology 2022Quote: ... supplemented with 5% Horse Serum (SIGMA #H1138), 0.5 μg/mL Hydrocortisone (SIGMA #H0888) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 5 ug/ml heparin (Sigma-Aldrich). Heparin ...
-
bioRxiv - Microbiology 2019Quote: ... and 5% inactivated fetal calf serum (Sigma), referred to as RPMI-1640 complete (RPMI-1640C)medium ...
-
bioRxiv - Neuroscience 2019Quote: ... and SR-95531 (gabazine; 5 μM, Sigma) to block NMDA and GABAA receptors ...
-
bioRxiv - Cancer Biology 2019Quote: ... RP (5’-GTGCCGTCACGCTCTATGTA) for PLK1 (Sigma-Aldrich), FP (5’-ATGTGTGTGGAGAGCGTCAA) ...
-
bioRxiv - Cancer Biology 2019Quote: ... RP(5’ACAGTTCCACAAAGGCATCC) for BCL2 (Sigma-Aldrich), FP (5’ACCTGCAGCAATACCATTGAC) ...
-
bioRxiv - Cancer Biology 2019Quote: ... RP (5’AAGGTGAGGGACTCAAACTGC) for STAT3 (Sigma-Aldrich) and FP (5’-AGAAGGCTGGGGCTCATTTG) ...
-
bioRxiv - Cancer Biology 2019Quote: ... RP (5’-AGGGGCCATCCACAGTCTTC) for GAPDH (Sigma-Aldrich). The threshold cycle (Ct ...
-
bioRxiv - Immunology 2020Quote: ... Then blocked in 5% goat serum (Sigma), 3% bovine serum albumin (Fisher ...
-
bioRxiv - Genetics 2019Quote: ... and 5 μg/mL actinomycin D (Sigma) to inhibit trans-splicing and de novo transcription (30) ...
-
bioRxiv - Developmental Biology 2020Quote: ... and 5 mM Bis-Tris (Sigma B4429). Half of the total dissected discs were transferred to 24-well tissue culture dishes containing this prepared media + 5 ∝g/mL Actinomycin D ...
-
bioRxiv - Immunology 2020Quote: ... InvivoGen) or 5 μg of LPS (Sigma), 24 hours apart ...
-
bioRxiv - Biochemistry 2019Quote: ... anti-tubulin (B-5-1-2, Sigma), anti-FLAG (M2 ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 5 g.L−1 ammonium sulfate (Sigma)) at 30°C with rigorous shaking (200 rpm) ...
-
bioRxiv - Genetics 2020Quote: ... and 5 μM DAPT (Sigma-Aldrich, USA). Cells were then cultured on semipermeable supported membranes (Transwell ...
-
bioRxiv - Neuroscience 2019Quote: ... 5-HT (1:200, Millipore Sigma, MAB352), and VGLUT2 (1:200 ...
-
bioRxiv - Neuroscience 2019Quote: ... + 5 ug/mL Laminin (Sigma-Aldrich #L2020). 150,000 cells were plated on a pre-coated 48-well MEA plate in a 25 uL drop ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5 g/ mL ascorbic acid (Sigma-Aldrich), 10 mmol/L HEPES (PAA Laboratory ...
-
bioRxiv - Cell Biology 2020Quote: ... containing 5% fetal bovine serum (Sigma Aldrich) in an atmosphere of 5% CO2 at 37°C as described previously (Johnson et al. ...
-
bioRxiv - Pathology 2020Quote: ... 5 μg/mL (all from Sigma-Aldrich). Plasmids were transformed into electrocompetent Psa3 (Choi et al. ...
-
bioRxiv - Molecular Biology 2019Quote: ... antibiotics and 5% fetal calf serum (Sigma). Injected oocytes were incubated at 38.5 °C in a humidified atmosphere of 5% CO2 for 20 h.
-
bioRxiv - Cancer Biology 2019Quote: ... Indole-5-carboxylic acid (Sigma Aldrich; I5400) and Indole-3-propionic acid (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μl of CellLytic express (Sigma-Aldrich) was added ...
-
bioRxiv - Cancer Biology 2020Quote: ... Phenol acid chloroform 5:1 (Sigma-Aldrich) and NaCl 10 mM were then added ...
-
bioRxiv - Cancer Biology 2019Quote: ... supplemented with 5% human serum (H4522, Sigma) and 100 U Penicillin/Streptomycin ...
-
bioRxiv - Pathology 2020Quote: ... 5 μg/ml insulin (Sigma Aldrich, #I9278), 10 ng/ml epidermal growth factor (Sigma Aldrich ...
-
bioRxiv - Pathology 2020Quote: ... 5 μg/ml transferring (Sigma Aldrich, #T1428), 50 nM dexamethasone (Sigma Aldrich ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 µg/ml α-amanitin (Sigma-Aldrich) treatment was applied for 25-30 hours before RNA extraction or FRAP analysis ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 mg/mL Lysing Enzymes (L1412 Sigma); 5 mg/mL L-cysteine dissolved in OB) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 ug/mL of MTT (Sigma-Aldrich) was added for 30 min and the mammospheres were counted by using GelCount (Oxford Optoronix) ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 µg/mL of cisplatin (Sigma, USA) and 0.2 µg/mL of ACTD respectively ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 μM ATP (Sigma-Aldrich #FLAAS-1VL) in lysis buffer) ...