Labshake search
Citations for Millipore Sigma :
3001 - 3050 of 10000+ citations for Biotin Z Antibody Internalization Kit mouse since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
p110α-dependent hepatocyte signaling is critical for liver gene expression and its rewiring in MASLDbioRxiv - Cell Biology 2024Quote: Plasma FGF21 and insulin were assayed using the rat/mouse FGF21 ELISA kit (EMD Millipore) and the ultrasensitive mouse insulin ELISA kit (Crystal Chem) ...
-
bioRxiv - Molecular Biology 2024Quote: PLA was performed using the DuoLink In Situ Red Starter Kit Mouse/Rabbit (DUO92101, Sigma). µ-slide 8-wells (Ibidi ...
-
bioRxiv - Developmental Biology 2022Quote: ... mouse anti-mouse αSMA (Sigma A2547), goat-anti-human TIE1 (R&D AF619) ...
-
bioRxiv - Molecular Biology 2023Quote: AKT:FBP1:ALDOB:PP2A-C interactions in liver tissue were detected with an in situ PLA kit (Duolink® In Situ Red Starter Kit Mouse/Rabbit, Sigma, DUO92101) (Su et al. ...
-
bioRxiv - Physiology 2023Quote: ... FGF21 was measured by using a commercially available enzyme-linked immunosorbent assay kit (rat/mouse FGF21 enzyme-linked immunosorbent assay kit; Millipore, Billerica, MA), according to the manufacturer’s instructions.
-
bioRxiv - Biophysics 2020Quote: ... 304 μL BPTI (4 different concentrations ranging from 5.2 to 52.6 μM) was mixed with 8 μL of the substrate Z-GPR-pNA (Sigma-Aldrich, St. Louis, MO) (5 different concentrations ranging from 0.4 to 10 mM) ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were treated with 500nM 4-hydroxytamoxifen (4-OHT) for 72h in 5i+LIF (Supplementary Table1) with 100 μM apoptosis inhibitor Z-vad (Sigma-Aldrich®) and 50 μM of necroptosis inhibitor Necrostatin-1 (Sigma-Aldrich®) ...
-
bioRxiv - Microbiology 2021Quote: ... The source voltage and focusing voltages were tuned for the transmission of MRFA peptide (m/z 524) (Sigma-Aldrich, St. Louis, MO). Data-dependent analysis was carried out in orbitrap-IT parallel mode using CID fragmentation on the five most abundant ions in each cycle ...
-
bioRxiv - Cancer Biology 2019Quote: ... Established cell lines were propagated in DMEM containing 10% FBS and maintained with 100nM of (Z)-4-hydroxytamoxifen (4-OHT) (Sigma-Aldrich H7904) and routinely evaluated for mycoplasma contamination ...
-
bioRxiv - Developmental Biology 2024Quote: ... Tg(actab2:loxP-BFP-STOP-loxP-dsRed)sd27 fish were treated overnight at 5 dpf with 5 μM (Z)−4-Hydroxytamoxifen (4-OHT) (Sigma-Aldrich H7904) in EM ...
-
bioRxiv - Biochemistry 2021Quote: ... primary antibodies followed by anti-mouse (#A4416) and anti-rabbit (#A0545) secondary antibodies conjugated to horseradish peroxidase (both are from Millipore-Sigma and used at 1:10,000). WesternBright Sirius chemiluminescent horseradish peroxidase substrate (Advansta ...
-
bioRxiv - Molecular Biology 2019Quote: ... Primary antibody incubation was performed at room temperature for 45min (Monoclonal ANTI-FLAG® M2 antibody produced in mouse Millipore-Sigma F1804 at 1/250 dilution), followed by three 5 min washes in 1X PBS ...
-
bioRxiv - Molecular Biology 2019Quote: ... Primary antibody incubation was performed at room temperature for 45min (Monoclonal ANTI-FLAG® M2 antibody produced in mouse Millipore-Sigma F1804 at 1/250 dilution), followed by three 5 min washes in 1X PBS ...
-
bioRxiv - Bioengineering 2020Quote: ... co-staining was performed using rabbit anti-perilipin A antibody as an adipocyte marker in combination with a mouse anti-human mitochondria (hMito) antibody conjugated with Cy3 (EMD Millipore, Burlington, USA; 1:100 dilution). hMito was used as an alternative to Ku80 based on the availability of antibodies compatible for co-staining ...
-
bioRxiv - Cancer Biology 2021Quote: ... The blot was then incubated with a polyclonal anti-AE2 C-terminal antibody (anti-AE2Ct) or the mouse monoclonal anti α-tubulin antibody (Sigma Aldrich, St. Louis, MO, USA) in TBS-Tween 20 + 0.1% BSA ...
-
bioRxiv - Cancer Biology 2019Quote: ... polymerase (PARP)-1 polyclonal antibody (1:1000; Epitomics, Burlingame, CA, USA) and a mouse anti-β-actin antibody (1:10000; Sigma-Aldrich, St. Louis, MO, USA), followed by incubation with secondary antibodies and chemiluminescence detection.
-
bioRxiv - Systems Biology 2020Quote: ... Alpha and beta pancreatic cells were evaluated in dewaxed sections using specific primary antibodies (mouse monoclonal anti-Glucagon and anti-Insulin antibodies, Sigma-Aldrich Corp., St. Louis, Mo. USA). Rabbit polyclonal antibodies against PDX1 ...
-
bioRxiv - Neuroscience 2020Quote: ... Iba1 (rabbit, WAKO;, RRID: AB_839504) were visualized by avidin-biotin technique with 3,3-diaminobenzidine (DAB, Sigma) according to standard procedures of the UKE Mouse Pathology Facility using the ultraView Universal DAB Detection Kit (Ventana) ...
-
bioRxiv - Biochemistry 2020Quote: ... The sequence of the biotinylated 2’-deoxyoligonucleotide is 5’ – (Biotin) AAATGGTGCCGAAACCCGGGATCGAACCAGGGT – 3’ (Sigma Aldrich, Munich, Germany)
-
bioRxiv - Neuroscience 2021Quote: ... Additional blocking by incubation with avidin and biotin (both 0.001% in PB, Sigma-Aldrich, Darmstadt, Germany) for 30 min and a 10 min wash with PBST in between were carried out before incubation with the blocking solution ...
-
bioRxiv - Neuroscience 2020Quote: ... followed by avidin-biotin complex and developed in solution containing 0.025% 3,3’-diaminobenzidine tetrahydrochloride (Sigma-Aldrich), 10 mM imidazole ...
-
bioRxiv - Cell Biology 2022Quote: ... Tubes were kept at 37°C in a water bath and D-biotin (B4501; Sigma-Aldrich) was added at a final concentration of 500 μm ...
-
bioRxiv - Cell Biology 2020Quote: The mixture was incubated with Dibenzocyclooctyne-PEG4-biotin conjugate (Sigma-Aldrich #760749; 50 μM final concentration) in a reaction volume of 100 μl for 1 h on a rotator in slow motion (9 rpm ...
-
bioRxiv - Microbiology 2022Quote: ... Unconjugated biotin was removed by centrifugation using a 50 kDa Amicon Ultra size exclusion column (Millipore). To determine the average number of biotin molecules bound to each molecule of F ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were transferred to ice and surface biotin was cleaved with 60 mM MesNa (Sigma, 63705) in MesNa buffer (50 mM Tris-HCl [pH 8.6] ...
-
bioRxiv - Immunology 2020Quote: ... Unconjugated biotin was removed by centrifugation using a 50 kDa Amicon Ultra size exclusion column (Millipore). To determine the average number of biotin molecules bound to each molecule of F ...
-
bioRxiv - Cell Biology 2022Quote: ... 10% biotin tubulin and 4% HiLyte647-tubulin) in the presence of 2.5 mM GTP (Sigma-Aldrich) and 20 μM Taxol (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2024Quote: ... the following reagents were added: 10 μL of 10 mM biotin picolyl azide (Sigma Aldrich, 900912) in DMSO ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cells were treated with 1 μg/mL doxycycline and 50 μM biotin (Sigma-Aldrich # B-4639) for 24 hours for BirA* fusions or 30 minutes for miniTurbo fusions ...
-
bioRxiv - Immunology 2024Quote: ... 8 µM 6-biopterin,1 mg/L biotin and 1x RPMI 1640 vitamins solutions (Sigma, USA). Parasites in culture were passaged to fresh medium at a one 20th-50th dilution once a week.
-
bioRxiv - Genomics 2022Quote: ... The chips were further reacted with PC biotin-PEG3-NHS ester (0.2 mg/ml, Sigma-Aldrich) for 1 hour and then then labeled with streptavidin conjugated with Alexa FluorTM 568 (0.04 mg/ml in depc-PBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... Unincorporated biotin was removed by washing the mRNA three times with H2O (molecular biology grade, Millipore) in an Amicon membrane centrifugal concentrator with a molecular weight cutoff (MWCO ...
-
bioRxiv - Plant Biology 2023Quote: ... 10 µM CuSO4 (or water as a control) was co-infiltrated with Biotin (200 µM) (Sigma) at 24 hpi ...
-
bioRxiv - Biochemistry 2023Quote: ... the following reagents were added: 10 μL of 10 mM biotin picolyl azide (Sigma Aldrich, 900912) in DMSO ...
-
bioRxiv - Immunology 2024Quote: ... Cell surface-bound Abs were detected with specific biotin-conjugated secondary Ab (1/500; Sigma-Aldrich).
-
bioRxiv - Bioengineering 2024Quote: ... in 950 µL PBS for 2 h at room temperature (RT) with Biotin-NHS (H1759, Sigma) in a 1:20 molar ratio (G-CSFR:Biotin-NHS) ...
-
bioRxiv - Microbiology 2020Quote: ... The supernatant from this clarification step were incubated with mouse anti-FLAG antibody (Sigma, clone M2 1µg/ml) over night at 4ºC with gentle rocking ...
-
bioRxiv - Biochemistry 2021Quote: ... membranes were incubated with TBST-Blotto containing primary monoclonal mouse anti-FLAG M2 antibody (1:2,000 dilution, Sigma) or monoclonal mouse anti-GAPDH antibody (1:2,000 dilution ...
-
bioRxiv - Systems Biology 2020Quote: ... samples were analyzed for β-actin expression using a mouse anti-β-actin antibody (1:5,000, Sigma Aldrich) and a HRP-labeled goat anti-mouse antibody (1:10,000 ...
-
bioRxiv - Immunology 2021Quote: ... Cell lysates were reprobed with a mouse monoclonal antibody anti-β-actin (clone C4, Millipore; 1:5,000 dilution).
-
bioRxiv - Neuroscience 2020Quote: ... Sections were then incubated in a primary antibody solution containing 1:250 mouse anti-NeuN (Millipore; MA, USA), 1:200 goat anti-DCX(Santa Cruz Biotechnology ...
-
bioRxiv - Developmental Biology 2020Quote: ... The following antibodies were used: mouse anti-acetylated tubulin (clone 6-11b-1, Sigma-Aldrich, diluted 1:2000) and goat anti-mouse Alexafluor 488 (Invitrogen ...
-
bioRxiv - Bioengineering 2022Quote: ... The following primary antibody were used in this study: β-tubulin III (mouse, Sigma Aldrich T8660, 1:1000), TH (rabbit ...
-
bioRxiv - Developmental Biology 2022Quote: ... and a mouse anti-acetylated α-tubulin antibody (clone 6-11B-1, Millipore-446 Sigma, #MABT868, 1:500) to co-stain cell boundaries ...
-
bioRxiv - Developmental Biology 2022Quote: ... and a mouse anti-acetylated α-tubulin antibody (clone 6-11B-1, Millipore-446 Sigma, #MABT868, 1:500) to co-stain cell boundaries ...
-
bioRxiv - Neuroscience 2021Quote: ... Membranes were incubated with HRP-linked secondary antibodies anti-mouse IgG (1:5000, A6782, Sigma-Aldrich, MO, USA) and anti-rabbit IgG (1:5000 ...
-
bioRxiv - Genetics 2019Quote: ... The bound anti-BrdU antibody was subsequently detected by anti-mouse IgG-FITC conjugate (Sigma, dilution 1:64) under a fluorescence microscope after mounting the ganglia in antifade (Sigma).
-
bioRxiv - Cell Biology 2020Quote: The primary antibodies used (with their respective working dilutions) were: anti-FLAG (Sigma F1804, mouse, WB: 1/1000), anti-pan-acetyl lysine (AcK ...
-
bioRxiv - Developmental Biology 2019Quote: ... The following antibodies were used: Monoclonal mouse anti-FLAG M2-Peroxidase (HRP) (Sigma-Aldrich; A8592, dilution: 1:1,000). Monoclonal mouse anti-Actin clone C4 (Millipore ...
-
bioRxiv - Cell Biology 2019Quote: ... The following primary antibodies were used for western blotting studies: mouse anti-α-tubulin DM1A (Sigma-Aldrich, RRID:AB_477593) used at 1:10000 ...