Labshake search
Citations for Millipore Sigma :
2951 - 3000 of 10000+ citations for 6 Amino 2 4 difluorobenzotrifluoride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... and acetylated-α-tubulin (1:5000; Sigma 6-11-B1). Conjugated secondary antibodies were purchased from Invitrogen Life Technologies (Carlsbad ...
-
bioRxiv - Pathology 2020Quote: ... sodium phosphate (Sigma Aldrich, 7782-85-6, St. Louis, MO), sodium chloride (BDH ...
-
bioRxiv - Neuroscience 2019Quote: ... 250µL of 6% (w/v) carmine red dye (Sigma-Aldrich) in 0.5% (w/v ...
-
bioRxiv - Cancer Biology 2019Quote: 6-Diazo-5-oxo-L-norleucine (Don, D2141, Sigma, UK); Sodium dichloroacetate (DCA ...
-
bioRxiv - Neuroscience 2021Quote: ... and unilaterally injected with 6-OHDA (Sigma-Aldrich A/S) (2 µl of 7 µg/µl free base in saline containing 0.02% ascorbic acid ...
-
bioRxiv - Microbiology 2021Quote: ... and supplemented with 6% inactivated fetal calf serum (iFCS, Sigma). The human macrophage-like cell line U937 (ATCC no ...
-
bioRxiv - Plant Biology 2020Quote: ... PGM buffer (6% mannitol, 3% sucrose, M5524 MS salts (Sigma), M7150 vitamins (Sigma) ...
-
bioRxiv - Developmental Biology 2019Quote: ... 2009.) and were resuspended in 6 M Guanidine HCl (Sigma cat# G3272-1KG ...
-
bioRxiv - Genomics 2019Quote: ... One of these wells received 5 µM 6-TG (Sigma) in DMSO for negative selection and the other received DMSO as a control (mock selection) ...
-
bioRxiv - Cell Biology 2021Quote: ... acetylated α-tubulin (mAb 6-11B-1 T6793; Sigma-Aldrich;), S tag (EMD Millipore ...
-
bioRxiv - Biochemistry 2020Quote: ... the synthetic single-stranded oligonucleotides (Sigma-Aldrich, Supplementary Table 6) were diluted in sterile water to 200 nM ...
-
bioRxiv - Biochemistry 2021Quote: ... supplemented with 6 mg/ml chicken egg white lysozyme (Sigma). Samples were incubated at 37°C for 30 minutes under shaking ...
-
bioRxiv - Cell Biology 2019Quote: ... or a cocktail of protease inhibitors: 6 µM Leupeptine (Sigma), 0.044 TUI/mL Aprotinine (Sigma) ...
-
bioRxiv - Cell Biology 2020Quote: ... PZ0233)– 10 μM in H2O (6) IRE1 inhibitor 4μ8c (Sigma, SML0949) – 64μM in DMSO (7 ...
-
A bacterial derived plant- mimicking cytokinin hormone regulates social behaviour in a rice pathogenbioRxiv - Microbiology 2021Quote: ... 6-(γ,γ-dimethylallylamino) purine (Sigma; Cat. No: D5912-5G) was used for calculation of standard curve.
-
bioRxiv - Genomics 2019Quote: ... 6 μg/mL methyl methanesulfonate (MMS, Sigma-Aldrich, MO, USA) or 12 μg/mL N-Nitroso-N-ethylurea (ENU ...
-
bioRxiv - Microbiology 2021Quote: ... 2019-nCoV_N1 Probe (6-FAM / BHQ-1) ACCCCGCATTACGTTTGGTGGACC (Sigma Aldrich) for amplifying RNA from the SARS CoV-2 N-1 gene ...
-
bioRxiv - Developmental Biology 2021Quote: ... acetylated α-tubulin (mAb 6-11B-1, Sigma; 1:2000), GFP (Abcam ab13970) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 6 μM carbonyl-cyanide p-triflouromethoxyphenylhydrazone (FCCP) (Sigma-Aldrich C2920) and 4.5 μM Antimycin A (Sigma-Aldrich A8674) ...
-
bioRxiv - Bioengineering 2022Quote: ... the 6 wt.% gelatin solution (Porcine skin, Type A, Sigma) in deionized (DI ...
-
bioRxiv - Neuroscience 2022Quote: ... 10 μM 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX, Sigma) and 50 μM D ...
-
bioRxiv - Microbiology 2022Quote: ... 6 mL of 1% crystal violet (CV) solution (Sigma-Aldrich) was added to the well and incubated for 15 min at 25 °C ...
-
bioRxiv - Neuroscience 2022Quote: ... 10 μM 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX, Sigma) and 50 μM D,L-2-amino-5-phosphonovaleric acid (AP5 ...
-
bioRxiv - Genetics 2022Quote: ... myoblasts were incubated with 6 μM of 5AzadC (Sigma, A3656) for 24h ...
-
bioRxiv - Neuroscience 2022Quote: ... 6 days following induction cells were dissociated with Accumax (Millipore), collected and centrifuged ...
-
bioRxiv - Neuroscience 2024Quote: ... Nonspecific biding was blocked by 6% bovine serum albumin (Sigma) for 30 min at room temperature ...
-
bioRxiv - Neuroscience 2024Quote: ... A solution of carmine red (200 μl; 6%; C1022, Sigma) suspended in 0.5% methylcellulose (M0512 ...
-
bioRxiv - Neuroscience 2024Quote: ... Unilateral nigrostriatal lesions were created by injecting 6-OHDA (Sigma, St ...
-
bioRxiv - Neuroscience 2024Quote: ... 6-Cyano-7-nitroquinoxaline-2,3-dione (CNQX, 10 μM, Sigma), D-APV (D-(-)-2-amino-5-phosphonvaleric acid ...
-
bioRxiv - Genomics 2023Quote: ... along with 6 ug/ml of polybrene (Sigma-Aldrich, H9268). The medium was replaced on day 3 to remove the polybrene ...
-
bioRxiv - Neuroscience 2024Quote: ... 6 mg/mL glucose and 1x penicillin/streptomycin (Sigma, #P0781) was added and plates were incubated at 37°C and 5% CO2 ...
-
bioRxiv - Neuroscience 2023Quote: We used the dopamine toxin 6-hydroxydopamine-hydrobromide (Sigma, #162957) to ablate dopamine neurons in the hindbrain and striatum by injecting anesthetized tadpoles with ∼50 nl of OHDA or saline into target regions of each hemisphere using a Nanoject ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 6 treated with 10µM DMH4 (Sigma Aldrich, Cat D8696). Wildtype 2 includes 5 wild type embryos at 5 dpf and 5 wild type embryos at 3 dpf ...
-
bioRxiv - Cell Biology 2023Quote: ... A solution of 6% carmine red (300 µl, Sigma, C1022) was prepared using 0.5% methylcellulose (Sigma ...
-
bioRxiv - Biochemistry 2023Quote: ... 25 uL of (His)6-tagged TEV-protease (Sigma-Aldrich) was added and the solution incubated overnight at 4°C.
-
bioRxiv - Cell Biology 2023Quote: ... TA muscles were mounted on 6% tragacanth gum (Sigma, #G1128) and frozen in isopentane (Sigma ...
-
bioRxiv - Neuroscience 2023Quote: ... in 6-well dishes over media (1x MEM (Millipore-Sigma), 1x GLUTAMAX (Gibco ...
-
bioRxiv - Molecular Biology 2023Quote: ... and Hep3B2.1-7 in 6-well CellBIND plates (Sigma Aldrich) for GFP assays ...
-
bioRxiv - Developmental Biology 2023Quote: ... Primary antibodies used included acetylated tubulin (6-11B-1, Sigma), MmIFT27 (33 ...
-
bioRxiv - Developmental Biology 2023Quote: ... 6 PAR explants were placed on Nucleopore membrane filters (Millipore) supported by fine meshed metal grids (Goodfellows ...
-
bioRxiv - Immunology 2023Quote: ... 1 ug/mL FSL-1 (TLR2/6 agonist, Sigma Aldrich), and 1 ug/mL LPS (TLR4 agonist from E ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were treated with 6 µM CHIR99021 (Sigma, Cat#: SML1046) for 2 days in LaSR basal medium consisting of advanced DMEM/F12 (Fisher Scientific ...
-
bioRxiv - Biochemistry 2023Quote: ... acetylated α-tubulin (mAb 6-11B-1, Sigma; 1:2000), GLI2 (1:500 ...
-
bioRxiv - Cancer Biology 2023Quote: ... for 6 h and 50 nM bafilomycin A1 (Millipore, # B1793) for 5 h respectively in growth medium ...
-
bioRxiv - Immunology 2023Quote: ... 1 ug/mL FSL-1 (TLR2/6 agonist, Sigma Aldrich), and 1 ug/mL LPS (TLR4 agonist from E ...
-
bioRxiv - Neuroscience 2023Quote: ... in 6-well dishes over media (1x MEM (Millipore-Sigma), 1x GLUTAMAX (Gibco ...
-
bioRxiv - Biochemistry 2023Quote: ... and FAM (5(6)-carboxyfluorescein) were purchased from Sigma-Aldrich. D-biotin was purchased from GoldBio ...
-
bioRxiv - Biophysics 2023Quote: ... The solution was mixed and 6 % of methacrylic anhydride (Sigma), 9 µL of Irgacure initiator (Advanced Biomatrix ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 6 mL of 25% m/m potassium hydroxide (Sigma, USA) in methanol (Sigma ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and triphenol phosphate (TPP, 115-86-6, >99%, Sigma Aldrich) because they were (1 ...