Labshake search
Citations for Millipore Sigma :
251 - 300 of 2392 citations for bta mir 486 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2023Quote: ... Our method of genotyping involved PCR amplification across mutation sites using the primers described in Table 1 (purchased from Sigma Aldrich). Then ...
-
bioRxiv - Biochemistry 2024Quote: ... R-domain phosphorylation sites and interacting residues mutants were generated by site-directed mutagenesis using a Q5-New England Biolabs PCR mutagenesis kit together with primers synthesized from Millipore sigma and verified by sequencing (Elim Biopharmaceuticals ...
-
bioRxiv - Plant Biology 2019Quote: ... The allele-specific forward primers and common reverse primers were synthesised by Sigma-Aldrich. Allele-specific primers were synthesised with standard FAM or VIC compatible tails at their 5’ ends (FAM tail ...
-
bioRxiv - Microbiology 2021Quote: ... Top2β: Forward primer 5’CAGCCCGAAAGACCTAAATAC and reverse primer 5’ATCTAACCCATCTGAAGGAAC obtained from Sigma-Aldrich.
-
bioRxiv - Plant Biology 2023Quote: ... 8 pmol M13-labeled forward primer and 32 pmol reverse primer (Sigma Life Science), standard Taq buffer (New England Biolabs) ...
-
bioRxiv - Developmental Biology 2024Quote: ... Primers were designed using Primer-BLAST (National Institutes of Health) and obtained from Sigma. For each primer pair ...
-
bioRxiv - Microbiology 2021Quote: ... and oligonucleotide primers (Sigma-Aldrich) used for experimental work in this study are listed in Table 1 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Primers were synthesized by Sigma and IDT.
-
bioRxiv - Neuroscience 2019Quote: ... The following primers (Sigma-Aldrich), mapping outside the ssODN sequence were used to amplify a region of ≈ 700 bps containing the edited region of the Pde6b gene ...
-
bioRxiv - Microbiology 2019Quote: ... Primers were purchased from Sigma and their sequences listed in Table 3 ...
-
bioRxiv - Neuroscience 2020Quote: ... Primers used (Sigma, Dublin, Ireland) are listed in Table S4.
-
bioRxiv - Neuroscience 2021Quote: ... The DNA primers (Sigma-Aldrich) used for genotyping are listed in Table S7.
-
bioRxiv - Bioengineering 2020Quote: ... Custom designed primers (Sigma-Aldrich) with the sequences presented in Table 1 were used as myogenic and immunogenic markers ...
-
bioRxiv - Neuroscience 2020Quote: ... Primers were ordered from Sigma as lyophilized and reconstituted in Milli-Q water to a stock concentration of 100 μM and further diluted to a 10 μM working stock ...
-
bioRxiv - Physiology 2022Quote: ... with Random Primers (Sigma-Aldrich) and incubated for 3 min at 70°C followed by addition of dNTPs ...
-
bioRxiv - Neuroscience 2022Quote: ... Forward and reverse primers (Sigma) targeting the telomere region and the 36B4 gene (single copy gene ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... All primer probes (Sigma-Aldrich) were designed to span exon boundaries ensuring amplification of only mRNA ...
-
bioRxiv - Cell Biology 2019Quote: ... Primers were synthetized by Sigma. qPCR reactions were performed on a LightCycler® 480 Real Time PCR System (Roche ...
-
bioRxiv - Cancer Biology 2019Quote: ... Primers were designed (Sigma Aldrich) and listed in Supplementary Table S3 ...
-
bioRxiv - Physiology 2020Quote: ... with Random Primers (Sigma-Aldrich) and incubated for 3 min at 70°C followed by addition of dNTPs ...
-
bioRxiv - Microbiology 2021Quote: ... plasmids and primers (Sigma, Singapore) used in this study are listed in S6 and S7 Tables ...
-
bioRxiv - Microbiology 2021Quote: ... and desalted primers (Sigma-Aldrich). The primers used in this study are shown in Table S4 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Sequences of primers (Genomed/Sigma) and annealing temperatures are listed in Table S2 in Supplementary Material ...
-
bioRxiv - Cell Biology 2022Quote: Primers were purchased from Sigma/Merck or IDT ...
-
bioRxiv - Microbiology 2023Quote: ... The primers (Sigma-Aldrich, Bangalore) for q-PCR are listed in Table S4 ...
-
bioRxiv - Neuroscience 2022Quote: KiCqStart SYBR green primers (Sigma) were used for quantitating the mRNA levels (Table-2 shows the primers used for quantitating miRNAs and mRNAs in ...
-
bioRxiv - Molecular Biology 2022Quote: ... The primer sequences (Genomed/Sigma) and annealing temperatures are listed in Table S1 in the Supplementary Material.
-
bioRxiv - Neuroscience 2022Quote: ... specific oligonucleotide primers (Sigma Aldrich) of the target genes and SYBR Green (KAPA Syber1 FAST PCR Master Mix (2X ...
-
bioRxiv - Physiology 2023Quote: ... with Random Primers (Sigma-Aldrich) and incubated for 3 min at 70°C followed by addition of dNTPs ...
-
bioRxiv - Microbiology 2023Quote: ... The primers (Sigma-Aldrich, Bangalore) for q-PCR are listed in supplementary tables S4 and S5 ...
-
bioRxiv - Developmental Biology 2023Quote: ... forward and reverse primers (Sigma), and nuclease free water to determine mRNA expression of MMPs 2,9 ...
-
bioRxiv - Developmental Biology 2023Quote: ... forward and reverse primers (Sigma), and nuclease free water to determine mRNA expression of MMPs 2,9 ...
-
bioRxiv - Biochemistry 2023Quote: ... Primers were obtained from Sigma. For primer sequences ...
-
bioRxiv - Physiology 2024Quote: ... Commercially available KiCqStart primers (Sigma) were used to measure mRNA expression of guinea pig Igf2 ...
-
bioRxiv - Molecular Biology 2023Quote: FLAG-tagged or HA-tagged cDNA fragment of DDX43 was amplified by RT-PCR from total RNA of silkworm ovaries and cloned into pIEx-1 vector (Merck Millipore/Novagen) or pIExZ vector by In-fusion cloning kit (Takara).
-
bioRxiv - Cancer Biology 2022Quote: ... Lysis buffer supplemented with freshly prepared protease inhibitors (Protease Inhibitor Cocktail Set I #539131 and Protease Inhibitor Cocktail Set III #539134, Millipore Sigma-Aldrich) and phosphatase inhibitors (Phosphatase Inhibitor Cocktail Set I #524624 and Phosphatase Inhibitor Cocktail Set II #524625 ...
-
bioRxiv - Cell Biology 2020Quote: ... and RT-qPCR was performed as described previously [48] using QuantiTect SYBR Green PCR kit and KiCqStart SYBR Green optimized primers from Sigma-Aldrich (KSPQ12012).
-
bioRxiv - Cell Biology 2021Quote: ... Primers were designed using the NCBI Primer designing tool and custom-synthesized by Sigma-Aldrich. The sequences of primers were listed in Supplementary Table ...
-
bioRxiv - Developmental Biology 2022Quote: ... with 200 nM of forward and reverse primers (Sigma-Aldrich; primers listed in table 2) on a QuantStudio 5 (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2023Quote: ... The primers were predesigned and synthesized by Sigma-Aldrich (KiCqStart® SYBR® Green Primers). 20 ng cDNA was added to each well of a 96-well PCR plate with 1 μM forward and reverse primer for each nucleator ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 µl protease inhibitor cocktail set (EDM Millipore 539134), and 10 µl murine RNase inhibitor (200U ...
-
bioRxiv - Neuroscience 2021Quote: ... and sterilized using stericup and steritop filtration set (Millipore). Dentate gyrus and SVZ were microdissected using SteREO Discovery V8 microscope (Zeiss ...
-
bioRxiv - Molecular Biology 2019Quote: ... supplemented with Protease Inhibitor Cocktail Set III (Merck Millipore), mixed by rotation at 4°C for 30 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... complemented with protease inhibitor cocktail set III (Merck Millipore) and phosphatase inhibitor cocktail II (AG Scientific) ...
-
bioRxiv - Genetics 2021Quote: ... and phosphatase inhibitors (Phosphatase Inhibitor Cocktail Set II, Millipore). Cells were lysed with glass beads in a cooled FastPrep (MP Biomedicals) ...
-
bioRxiv - Immunology 2020Quote: ... combined with on-Column DNase I Digestion Set (Sigma). Reverse transcription was performed using qScript cDNA Synthesis Kit (Quanta biosciences ...
-
bioRxiv - Developmental Biology 2022Quote: ... The complete probe set was ordered from Sigma Aldrich. Equal volumes of all 20 single probes were mixed and used as probe mixture containing 5 μM of each probe in detection stage 3.
-
bioRxiv - Molecular Biology 2023Quote: ... The on-column DNase I digestion set (Sigma, DNASE70) was used for genomic DNA (gDNA ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... The control group was set with 0.1% DMSO (Sigma), and the blank control was set with water ...
-
bioRxiv - Neuroscience 2023Quote: ... and Phosphatase Inhibitor Cocktail Set V (Merck Millipore, 524629). The samples were pipetted 10-20 times up and down until dissolved and were incubated on ice for 20 min ...