Labshake search
Citations for Millipore Sigma :
251 - 300 of 9750 citations for Mouse Whole Genome Microarray since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: The whole amount of RNA was extracted from 20 testes using TRI reagent (Sigma, T9424), then purifying RNA was conducted by Directzol RNA MiniPrep kit-tel (Zymo Research ...
-
bioRxiv - Genetics 2021Quote: ... Embryonic tissues or whole embryos were isolated and fixed in 4% paraformaldehyde (Sigma PFA, 158127) in PBS.
-
bioRxiv - Developmental Biology 2021Quote: ... Embryonic tissues or whole embryos were isolated and fixed in 4% paraformaldehyde (Sigma PFA, 158127) in PBS.
-
bioRxiv - Neuroscience 2021Quote: ... mice were transcardially perfused with PBS and their whole brains fixed in 4% PFA (Sigma) for immunohistochemical analysis.
-
bioRxiv - Bioengineering 2021Quote: ... Whole constructs were permeabilized for 1 hr with 0.3% Triton X-100 (Sigma Aldrich, T8787) in 4% horse serum (ThermoFisher ...
-
bioRxiv - Biochemistry 2021Quote: Whole cell extracts (200-400 µg) were incubated with Myc- or Flag-conjugated beads (Sigma) for 3 hours or overnight at 4 °C ...
-
bioRxiv - Neuroscience 2020Quote: ... NMNAT1 whole body knockout mice were generated by injecting 100 μg/g 4-hydroxytamoxifen (Sigma) into 6 to 8 weeks old Nmnat1fl/fl ...
-
bioRxiv - Physiology 2021Quote: RNA was isolated from the whole brain using TRI reagent (Sigma, St Louis, MO, USA) and RNA concentration was tested using a Qubit 2.0 Fluorometer (ThermoFisher Scientific ...
-
bioRxiv - Cancer Biology 2020Quote: ... Whole pancreas tissue was digested with agitation in 1 mg/mL collagenase type V (Sigma) for 15 minutes at 37°C in RPMI buffer ...
-
bioRxiv - Microbiology 2022Quote: ... PBMCs were isolated from whole blood using Accuspin System Histopaque-1077 (Sigma-Aldrich, cat#10771). Studies involving human spleens were deemed non-human subjects research since tissue was de-identified ...
-
bioRxiv - Developmental Biology 2020Quote: ... Embryonic tissues or whole embryos were isolated and fixed in 4% paraformaldehyde (Sigma PFA, 158127) in PBS.
-
bioRxiv - Developmental Biology 2022Quote: All immunostainings were performed on whole-mount embryos fixed overnight in 4% paraformaldehyde (Sigma-Aldrich) in PBS at 4°C as previously described 88.
-
bioRxiv - Molecular Biology 2022Quote: ... Whole cell lysates were prepared by solubilizing cell pellets in CelLytic M (Sigma Cat# C2978), 1X Halt Protease Inhibitor cocktail (Thermo ...
-
bioRxiv - Molecular Biology 2019Quote: Whole flies or dissected ovaries were crushed with a pestle in TRI-Reagent (Sigma Aldrich). After DNase digestion of total RNA using the TURBO DNA-free™ Kit (Ambion) ...
-
bioRxiv - Immunology 2019Quote: ... whole thymuses were minced and incubated in cRPMI containing 1mg/ml collagenase Type IA (Sigma) and 400μg/ml DNase I (Roche ...
-
bioRxiv - Neuroscience 2021Quote: ... The whole nerve is placed in a graded series dehydration technique in Tetrahydrofuran (THF;Sigma) diluted in water ...
-
bioRxiv - Developmental Biology 2020Quote: ... Embryos used for whole-mount imaging were treated with 0.0045% 1-phenyl-2-thiourea (Sigma) to delay pigment formation ...
-
bioRxiv - Immunology 2020Quote: Fresh or cryopreserved human PBMC’s were isolated from heparinised whole blood by Ficoll gradient (Sigma). Cells were incubated for 1hr (37°C ...
-
bioRxiv - Neuroscience 2022Quote: ... The whole nerve was exposed to a graded series of dehydrations with tetrahydrofurane (THF; Sigma) diluted in water ...
-
bioRxiv - Developmental Biology 2022Quote: ... whole growing polyps were embedded in gelatin/albumin medium [0.4% gelatin type A (Sigma G1890), 27% albumin (Sigma ...
-
bioRxiv - Bioengineering 2022Quote: ... Whole blood was collected in citrated (3.2% w/v, Sigma-Aldrich, St. Louis, MI, USA) saline and incubated for 30 min with anti-CD42a antibody (1/100 dilution ...
-
Neuraminidase inhibitors rewire neutrophil function in vivo in murine sepsis and ex vivo in COVID-19bioRxiv - Immunology 2022Quote: Whole blood were incubated in the presence or absence of Oseltamivir (100 µM, Sigma-Aldrich), Zanamivir (30 µM ...
-
bioRxiv - Genetics 2022Quote: Whole ticks or dissected organs were homogenized in TRI Reagent (Sigma Aldrich, Saint Louis, MO) in a 1.5 mL microcentrifuge tube with a pestle (Kimble Kontes ...
-
bioRxiv - Microbiology 2022Quote: ... Cleared whole cell lysate was incubated with anti-FLAG M2 magnetic beads (Sigma #M8223-5ML) at room temperature for one hour ...
-
bioRxiv - Neuroscience 2022Quote: ... Preparations were then whole-mounted on slides with fluorosheild and DAPI purchased from Sigma Aldrich, USA ...
-
bioRxiv - Molecular Biology 2023Quote: Whole-cell extracts (200–1000 µg) were incubated with Myc- or FLAG-conjugated beads (Sigma) for 3 hr or overnight at 4 °C ...
-
bioRxiv - Genomics 2023Quote: Whole testes from opossum were fixed in Hartman’s Fixative (Sigma-Aldrich #H0290, Burlington, MA, USA) overnight at 4°C ...
-
bioRxiv - Cell Biology 2023Quote: ... whole-mounts or inserts were incubated overnight with 1 μg/ml DAPI (Sigma Aldrich, D9542) and secondary antibodies (1:500 ...
-
bioRxiv - Cell Biology 2023Quote: ... whole-mounts or inserts were incubated overnight with 1 μg/ml DAPI (Sigma Aldrich, D9542) and secondary antibodies (1:500 ...
-
bioRxiv - Cell Biology 2023Quote: ... ∼40 μg whole cell lysate was incubated with antibodies against γ-tubulin (Sigma-Aldrich, GTU88), phospho-Chk1 (Cell Signaling Technology ...
-
bioRxiv - Neuroscience 2023Quote: Whole-mount P1-2 neonatal murine cochleae were dissected in 1X ice-cold PBS (Sigma) and fixed in 4% formaldehyde for 10 min ...
-
bioRxiv - Neuroscience 2023Quote: ... For whole mount staining fixed zebrafish were permeabilized in 1 mg/mL collagenase D (Sigma) for 1.5 hours at RT ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Total RNA was isolated from the guppy whole brain using TRI Reagent (Sigma-Aldrich, USA) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: Whole zebrafish embryos were processed for western blotting following terminal anaesthesia using MS-222 (Sigma). Laemmli buffer was added to whole anaesthetised zebrafish embryos in the ratio of 8 μl per embryo ...
-
bioRxiv - Developmental Biology 2022Quote: ... mouse anti-mouse αSMA (Sigma A2547), goat-anti-human TIE1 (R&D AF619) ...
-
bioRxiv - Genomics 2023Quote: ... the microarray stripping protocol77 includes: (1) an overnight incubation in a protease solution (350 units of protease [Sigma 537088], 10%v/v SDS, and 10mM EDTA), 3 washes in 1xPBS with 0.5%v/v Tween20 ...
-
bioRxiv - Plant Biology 2020Quote: ... and hybridized overnight at 38°C with 32P-labeled probes for the intergenic region (IR) of the viral genome amplified by PCR (Fw: TCCTCTTTAGAGAGAGAACAATTGGGA, Rv: ACAACGAAATCCGTGAACAG) or oligonucleotides in PerfectHyb buffer (Sigma). Washed membranes were exposed to X-ray films at −80 °C for 3 days.
-
bioRxiv - Microbiology 2021Quote: ... Virus (genome equivalent of a MOI of 1) was added in the presence of 8 μg/ml polybrene (Sigma Aldrich) and the cells were incubated on ice for 1⍰ h to allow virus binding ...
-
bioRxiv - Biochemistry 2020Quote: ... The DNA sequence of each was verified (University of Vermont Cancer Center Advanced Genome Technologies Core) and then transformed into Escherichia coli Rosetta 2(DE3)pLysS competent cells (Novagen).
-
bioRxiv - Molecular Biology 2021Quote: ... and J-Lat 11.1 (integrated full-length HIV-1 genome mutated in env gene and GFP replacing Nef) cells were cultured in RPMI-1640 medium (Sigma) supplemented with 10% FBS and 100 μg/ml penicillin-streptomycin at 37 °C in a humidified 95% air-5% CO2 atmosphere ...
-
bioRxiv - Cell Biology 2021Quote: ... Sox9 overexpression was obtained by transfecting cardiac fibroblasts with full length Sox9 cDNA from the mammalian genome collection (Dharmacon) using X-treme Gene transfection reagent (Sigma) diluted in Opti-MEM media at a 4:1 ratio of transfection reagent to plasmid ...
-
bioRxiv - Biochemistry 2022Quote: ... fragments 1-206 or 1-184 and the full length Rad6 (KlRad6) were amplified from the Kluyveromyces lactis genome and inserted into vectors pET26B and pET28A (Novagen), respectively ...
-
bioRxiv - Microbiology 2022Quote: ... transfected parasites were selected in HFFs for integration of the plasmid into the genome with 25 μg/mL mycophenolic acid (Sigma) and 50 μg/mL xanthine (Sigma) ...
-
bioRxiv - Genomics 2022Quote: ... Genome extraction was then performed using the GenElute Bacterial Genomic DNA (gDNA) extraction kit (Sigma-Aldrich, St. Louis, MO, USA) as per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: HCT116 CRISPRi pCR2054 cells were transduced with lentivirus harboring constructs expressing sgRNAs from the genome-wide pooled CRISPRi v2 library with 8μg/mL of polybrene (TR-1003-G, EMD Millipore) at a multiplicity of infection (MOI ...
-
bioRxiv - Developmental Biology 2021Quote: RNA was extracted from whole implantation sites at E6.5 using Trizol (Cat. No. T9424, Sigma-Aldrich) according to the manufacturer’s instructions ...
-
bioRxiv - Zoology 2020Quote: ... The majority of whole-mount preparations were cleared in a solution of 2,2’thiodiethanol (Sigma-Aldrich), mounted on objective slides and analyzed ...
-
bioRxiv - Cancer Biology 2019Quote: ... Whole cell lysates were harvested using ice-cold RIPA buffer with 1x protease inhibitor (Sigma, P8340) and 1x phosphate inhibitor (Sigma ...
-
bioRxiv - Pathology 2019Quote: ... Whole blood was mixed with an equal volume of Alsever’s solution (Sigma Aldrich, cat. number A3551). Mice were then sacrificed by cervical dislocation ...
-
bioRxiv - Neuroscience 2021Quote: ... E12.5 and E13.5 whole heads were submerged in 4% paraformaldehyde in PBS (PFA; Millipore Sigma, 818715). E15.5 and E17.5 brains were dissected ...