Labshake search
Citations for Millipore Sigma :
251 - 300 of 10000+ citations for Mouse Ecto NOX Disulfide Thiol Exchanger 2 ENOX2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2019Quote: ... Mouse anti-NCAM Clone 2-2b (Millipore MAB5324, RRID:AB_95211, 1:250); Rabbit anti-OCT-4 (Cell Signaling Technology 2750 ...
-
bioRxiv - Cell Biology 2021Quote: ... and 12 ng/mL Fgf-2 from mouse (Sigma-Aldrich SRP3038). mESCs were passaged using StemProTM AccutaseTM (Thermo Fisher Scientific A1110501 ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse anti-His antibody (Sigma; 1:5,000 in PBS + 2% BSA) was added and incubated for 1h ...
-
bioRxiv - Genomics 2023Quote: ... mouse α-tubulin (1:10,000, B-5-1-2, Sigma Aldrich). Secondary HRP-conjugated antibodies (Sigma Aldrich ...
-
bioRxiv - Genetics 2020Quote: ... Specific primers for mouse leptin and 2 mouse housekeeping genes used for normalization (β-actin and 34B4 mouse genes) were purchased from Sigma (Sigma, France). We used primers for Leptin (forward ...
-
bioRxiv - Immunology 2020Quote: ... Total IgG response was evaluated by enzyme-linked immunosorbent assays (ELISAs) using 1:5000 dilution of HRP conjugated anti mouse secondary antibody (A4416, Sigma-Aldrich, USA).
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Plasma insulin and C-peptide were measured with mouse/rat ELISAs (EZRMI-13K and EZRMCP2-21K, respectively, EMD Millipore, Billerica, MA, USA). Plasma non-esterified fatty acids (NEFA ...
-
bioRxiv - Cell Biology 2021Quote: ... Insulin secreted from the islet grafts was measured in the mouse serum three weeks post-transplant using a human insulin ELISA (Millipore, EZHI-14K).
-
bioRxiv - Physiology 2021Quote: Cortisol concentrations were measured in mouse sera by a solid phase competitive enzyme linked immunosorbent assay (ELISA) (Sigma-Aldrich Co Ltd, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2020Quote: IgG mediated antibody titer of serum samples collected from immunized animals and convalescent patients’ sera were determined by enzyme-linked immunosorbent assay (ELISA)35 using 1:5000 dilution of HRP conjugated anti mouse (A4416, Sigma-Aldrich, USA) and 1:10000 dilution of HRP conjugated anti human secondary antibody (A0170 ...
-
bioRxiv - Neuroscience 2021Quote: ... C-reactive protein (CRP) was measured by an ELISA kit (cat. number CYT294, Millipore Sigma, Saint Louis, MO) following the manufacturer’s instructions.
-
bioRxiv - Biochemistry 2022Quote: ... also contained 1-2 µg/uL α-MBPAF546 or 1-2 µg/uL mouse α-BRCA2 (Ab1, Millipore) plus 1-2 µg/µL goat α-mouse IgGAF546 (Molecular Probes).
-
bioRxiv - Pathology 2019Quote: ... a Milliplex mouse cytokine magnetic kit (Millipore, France) was used according to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2022Quote: ... A Milliplex Mouse Th17 Luminex kit (EMD Millipore) with analytes IL-1β ...
-
bioRxiv - Immunology 2021Quote: ... A Milliplex Mouse Th17 Luminex kit (MD MilliPore) with analytes IL-1β ...
-
bioRxiv - Biochemistry 2020Quote: ... For ELISAs with asialofetuin (Sigma Aldrich # A4781), 5 μg/mL was immobilized ...
-
bioRxiv - Physiology 2023Quote: ... Insulin was measured by ELISA (Millipore Sigma). For glucose tolerance tests ...
-
bioRxiv - Immunology 2022Quote: ... IL-10 and TNF-α were determined in 24 h culture supernatant of UNT control and treated MOs using respective ELISA kits (Sigma-Aldrich kit, USA), according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2019Quote: ... The mouse VDAC1-specific shRNA sequence 2 GTTGGCTATAAGACGGATGAACT (Sigma-Aldrich, Ref. #TRCN0000012391), the VDAC1 shRNA sequence 3 ACCAGGTATCAAACTGACGTTCT (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2019Quote: ... mouse anti-alpha-tubulin ([B-5-1-2], Sigma, T5168, RRID AB_477582) and ATTO647N-conjugated anti-GFP nanobodies (GFPBooster-ATTO647N ...
-
bioRxiv - Pathology 2021Quote: ... Mouse anti-E2F4 monoclonal antibody (mAb) clone LLF4-2 (MABE160; Merck Millipore) used at 1/400 for PLA ...
-
bioRxiv - Pathology 2021Quote: ... 1 μg/mL natural mouse laminin and 2 μM Arabinosylcytosine (Sigma-Aldrich). 48 hours later NSM medium was fully exchanged ...
-
bioRxiv - Cancer Biology 2019Quote: ... α-tubulin mouse (1:10000 WB, clone B-5-1-2, Sigma-Aldrich), p120 catenin mouse (1:1000 WB ...
-
bioRxiv - Biophysics 2022Quote: ... and mouse myotubes were treated with thapsigargin (2 μg mL-1; Sigma) for 10 h ...
-
bioRxiv - Cancer Biology 2022Quote: ... mouse tubulin (clone B-5-1-2, Sigma, T5168-.2ML; 1/5000), and p21 Waf1/Cip1 (clone 12D1 ...
-
bioRxiv - Neuroscience 2022Quote: ... and anti-glutamate receptor 2 (mouse anti-GluR2 IgG2a; Millipore; 1:2000). Sections were then washed with PBS and incubated in Alexa Fluor-conjugated fluorescent secondary antibodies (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse monoclonal against alpha-tubulin (1:1000; b5-1-2, Sigma, T6074). Actin was stained using 100 nM of phalloidin-iFluor488 for 30 min ...
-
bioRxiv - Developmental Biology 2023Quote: ... mouse anti-Tubulin (1:3,000; Sigma clone B-5-1-2, T5168), and mouse anti-b-Actin (1:1,000 ...
-
bioRxiv - Immunology 2023Quote: ... Antibody binding to N protein was detected using conventional two-step ELISA with an HRPO-conjugated anti-mouse or anti-rat Fc antibody (Sigma Aldrich cat # A9309). All assays included a standard curve of mouse neutralising S1 antibody and mouse anti-N antibody (Sino Biological) ...
-
bioRxiv - Cancer Biology 2021Quote: ... and GM-CSF levels were quantified using ELISA kits pre-coated with indicated capture antibodies per manufacturer’s instructions (Sigma). IL-6 levels were preliminarily detected using a Q-Plex Human cytokine screen (16-plex ...
-
bioRxiv - Cell Biology 2023Quote: Proteins were extracted from 50 hpf zebrafish embryos using the lysis buffer from the calpain 1/2 activity kit (InnoZyme™ Calpain 1/2 Activity Assay Kit CBA054 purchased from Merck Millipore). Protein concentration was adjusted to 2 mg/mL and calpain enzymatic activity was measured in microtubes following the manufacturer instructions ...
-
bioRxiv - Immunology 2020Quote: ... the membranes were incubated with the appropriate horseradish-peroxidase conjugated secondary Ab (1:5000 in TBST + 2% BSA; 2 h at room temperature; anti-mouse A4416 and anti-rabbit A0545, Sigma). The immunoreactivity was detected by ECL reagents (Amersham) ...
-
bioRxiv - Bioengineering 2022Quote: ... Peanut-specific IgG1 was detected using goat anti-mouse IgG1-HRP conjugated (Southern Biotechnology Associates) and substrate TMB liquid substrate system for ELISA (Sigma-Aldrich, St. Louis, MO). The plates were read in an ELISA plate reader at 405 nM (IgE ...
-
bioRxiv - Immunology 2022Quote: ... LPS and insulin and ELISA against cardiolipin (Sigma) were performed as previously described48 ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... the ELISA substrate 3,3’,5,5’- tetramethylbenzidine (Sigma Aldrich) was used to visualise the reaction ...
-
bioRxiv - Immunology 2020Quote: ... All ELISA plates were developed with TMB (Sigma) and stopped with 1N sulfuric acid ...
-
bioRxiv - Immunology 2020Quote: ... ELISAs were developed with 3,3’,5,5’-Tetramethylbenzidine (Sigma) and optical densities were acquired with a Multiskan™FC (Thermo Scientific).
-
bioRxiv - Biophysics 2020Quote: ... ELISA signals were developed by adding TMB (Sigma) in 50 mM Na2HPO4 ...
-
bioRxiv - Genomics 2023Quote: ... Adiponectin concentrations were determined by using ELISA (Millipore). Plasma alanine transaminase (ALT ...
-
bioRxiv - Immunology 2024Quote: ... adiponectin and leptin were measured by ELISA (Millipore) following manufacturer protocol.
-
bioRxiv - Cell Biology 2024Quote: 96-well ELISA plates (Sigma-Aldrich, Cat#CLS3795) were coated with rat anti-RIPK3 (clone IH12 ...
-
bioRxiv - Neuroscience 2019Quote: ... and anti-α-Tubulin (mouse monoclonal [B-5-1-2], 1:8,000, Sigma).
-
bioRxiv - Neuroscience 2019Quote: ... anti-microtubule associated protein 2 (MAP2, 1:500, mouse monoclonal, Sigma, St.Louis, MO), GluN2B (1:1000 ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse mAb anti-α-Tubulin (Sigma-Aldrich, clone B-5-1-2, #T5168); mouse mAb anti-Flag M2 (Sigma-Aldrich #F1804) ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse monoclonal anti-Centrin-2 (1:250, clone 20H5, 04-1624, Merck Millipore), rabbit polyclonal anti-WDR90 (1:250 ...
-
bioRxiv - Neuroscience 2020Quote: ... and (3) GluA2 (mouse anti-glutamate receptor 2; Millipore; used at 1:2000). Cochlear pieces were incubated in species appropriate secondary antibodies coupled to Alexa Fluors in the red ...
-
bioRxiv - Microbiology 2021Quote: ... for SARS CoV-2 spike detection mouse anti-spike (Cat# ZMS1076, Sigma Aldrich) respectively ...
-
bioRxiv - Biophysics 2020Quote: ... or 2 ng/µl mouse anti-beta-tubulin primary antibody (Sigma-Aldrich, T8328), the clathrin samples were incubated with 2 ng/µl rabbit anti-clathrin primary antibody (Abcam ...
-
bioRxiv - Cell Biology 2021Quote: ... Mouse anti-actinin-2 (a7811) was purchased from Sigma Aldrich (St. Louis, MO). Rabbit anti-phosphoYAP (13008S ...
-
bioRxiv - Cancer Biology 2021Quote: ... mouse α-Tubulin (Sigma, B-5-1-2, # T5168, used at 1:5000), mouse α-FLAG (Sigma ...