Labshake search
Citations for Millipore Sigma :
251 - 300 of 10000+ citations for Estrone 3 Sulfate E1S ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... With primers comprising the respective restrictions sites (underlined) (F: 5’-3’ TGCAGACATATGAACCCCAACCACTCTG. R: 5’-3’ TACTAGAATTCCTAGACGCTCGATGTCGCC, Sigma-Aldrich, Germany), the full ORF was amplified from pCC2FOS-Mm3 by a standard PCR reaction using the Phusion DNA polymerase (New England BioLabs ...
-
bioRxiv - Molecular Biology 2023Quote: ... two siRNAs targeting this RBP (siPTBP1) were transfected into HeLa cells (siPTBP1_1: 5’-GCACAGUGUUGAAGAUCAU-3’; siPTBP1_2: 5’-AACUUCCAUCAUUCCAGAGAA-3’; Sigma-Aldrich), using the jetPRIME® (Polyplus Transfection ...
-
bioRxiv - Cell Biology 2023Quote: ... 5’CGUACGCGGAAUACUUCGA[dU][dU]3’) and Cofilin-1 (5’CCUCUAUGAUGCAACCUAU[dU][dU]3’)[78] have been synthetized by Sigma. In rescue experiments ...
-
bioRxiv - Neuroscience 2020Quote: ... before being washed in PB 0.05 M and mounted on slides using chromium (3) potassium sulfate dodecahydrate (Sigma-Aldrich) and left to dry ...
-
bioRxiv - Cell Biology 2022Quote: ... BubR1 5’GAUGGUGAAUUGUGGAAUAdTdT3’) or luciferase (5’ CGUACGCGGAAUACUUCGAdTdT 3’) was synthesized from Sigma and used for the RNAi.
-
bioRxiv - Cell Biology 2019Quote: ... Human c- peptide ELISA kit (cat # EZHCP-20K, Millipore MA), Human Insulin ELISA kit (cat # ELH- Insulin ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: A commercial kit (Rat RAGE/AGER ELISA, #RAB0009, Sigma-Aldrich) was used to quantify RAGE levels ...
-
bioRxiv - Microbiology 2024Quote: ... and the Bovine IFN-alpha ELISA Kit (Sigma-Aldrich, RAB1012) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... a copper (II) sulfate staining solution was prepared: 5g of copper (II) sulfate (Sigma, 12849) dissolved in 40mL HPLC-grade water ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... magnesium sulfate (MgSO4) and streptomycin sulfate salt were purchased from Sigma Aldrich (São Paulo, Brazil). Calcium chloride (CaCl2 ...
-
bioRxiv - Microbiology 2022Quote: ... pneumophila strains were cultured at 37°C in BYEα broth or BCYEα agar plates (67) containing 0.4 mg/ml L - cysteine sulfate (Sigma), 0.135 mg/ml ferric nitrate (Sigma) ...
-
bioRxiv - Genetics 2022Quote: ... Media aliquots were frozen and subjected to ENG ELISA analysis with the Human Endoglin ELISA kit (Sigma-Aldrich RAB0171) according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2023Quote: ... were diluted in PBS and used to coat MaxiSorp 96-well ELISA plates (Sigma; M9410) for 1hr at room temperature ...
-
bioRxiv - Immunology 2024Quote: ... Nunc MaxiSorp ELISA plates were precoated with dsDNA (100 mg/mL, Sigma, St. Louis, MO) in phosphate-buffered saline (PBS ...
-
bioRxiv - Cell Biology 2023Quote: ... After fixation cells were placed in hybridization buffer (5% dextran sulfate, 50% formamide, 5× SSC, 100 μg/ml heparin, 100 μg/ml sonicated salmon sperm DNA (Sigma-Aldrich, cat. No. D9156),0.1% Tween-20 ...
-
bioRxiv - Genetics 2021Quote: NGM plates were supplemented with 5-Fluorouracil (5-FU, Sigma, 15 µM) (Goudeau et al ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmodium-specific forward and reverse primer (12.5 pmol; Plas-7F 5’-GTTAAGGGAGTGAAGACGATCAGA-3’ and Plas-171R 5’-AACCCAAAGACTTTGATTTCTCATAA-3’; Sigma-Aldrich), PhHV-specific forward and reverse primer (15 pmol ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and oligonucleotides recognizing both lacO (5′-CATGTGGAATTGTGAGCGGATAACAATTTGTGG-3′) and Gal4 (5′-TCGACGGAGGACAGTCCTCCG-3′) sequences labelled with Biotin were purchased (Sigma). Oligonucleotides were mixed at 100 ng/μL and resuspended in hybridization buffer (50% formamide ...
-
bioRxiv - Biochemistry 2020Quote: To examine the RNA binding mode of the N-NTD we used a commercially available 7mer RNA duplex that was prepared by annealing of RNA oligonucleotides 5’-CACUGAC-3’ and 5’-GUCAGUG-3’ (Sigma). The RNA oligonucleotides were mixed in a molar ratio 1:1 at the final concetration 200 μM of each oligonucleotide and water supplemented with 50 mM NaCl ...
-
bioRxiv - Neuroscience 2021Quote: ... HT22 cells were infected with lentivirus carrying the control scrambled-shRNA (5’-CCGGCAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCTTCATCTTGTTGTTTTTG-3’) or CB-specific shRNA (5’-CCGGGATTGGAGCTATCACCGGAAACTCGAGTTTCCGGTGATAGCTCCAATCTTTTTG-3’) with polybrene (Sigma) for two days ...
-
bioRxiv - Cell Biology 2021Quote: High performance liquid-chromatography-purified RNA oligonucleotides 5’-(UG)12-3’ and 5’-(UC)12-3’ were ordered from Sigma. The oligonucleotides were biotinylated using the Pierce RNA 3’ End Desthiobiotinylation kit (Cat n° 20163 ...
-
bioRxiv - Physiology 2022Quote: The membrane-permeable 8-Br-cGMP (8-bromoguanosine 3′,5′-cyclic monophosphate, B1381) and 8-Br-cAMP (8-bromoadenosine 3′,5′-cyclic monophosphate, B5386) were from Sigma. ANP (AS-20648) ...
-
Competition co-immunoprecipitation reveals interactors of the chloroplast CPN60 chaperonin machinerybioRxiv - Molecular Biology 2023Quote: ... was PCR amplified from cDNA clone AV639302 (Kazusa) with oligos 5’-GCCAGGATCCGGAGAATTTATACTTCCAGGGTGCTACCCCCGTGCCCAAG-3’ and 5’-CGCGCGAAGCTTTTACGAGAGCTGGGCCAGG-3’ and cloned with BamHI and HindIII into petDUET (Novagen), giving pFW21 ...
-
bioRxiv - Plant Biology 2023Quote: ... Designed primers included standard FAM or HEX compatible tails (FAM tail: 5’ GAAGGTGACCAAGTTCAT-GCT 3’; HEX tail: 5’ GAAGGTCGGAGTCAACGGATT 3’ (Sigma)) Table S2) ...
-
bioRxiv - Cell Biology 2023Quote: ... AID Full Length F 5’-CCCAAGCTTATGGGCAGTGTCGAGCTG-3’ AID 1-114 F 5’-CCCAAGCTTATGGCAGTGTCGAGCTGAATC-3’ AID 31-114 F 5’-CCCAAGCTTAGAGGGTTCTCAGAGACGGTTG-3’ AID 71-114 F 5’-CCCAAGCTTAAAGATCCAGCCAAACCTCC-3’ AID R 5’-AAGGAAAAAAGCGGCCGCTACCTTCACGAACG-3’ PCR products were cloned into p3xFLAG-CMV10-PP6c construct (Sigma) using restriction digests and sequence confirmed ...
-
bioRxiv - Cancer Biology 2024Quote: ... 10 nM siRNA against DDX3X (5’-CCUAGACCUGAACUCUUCAGAUAAU dTdT-3’) or 20 nM siRNA against GRSF1 (5’-GUGCCUCUCUGCUGCCGCAdTdT-3’) which were synthesized by Sigma. Cells were subsequently incubated at 37 °C for 48 h before harvesting and analysis ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... A saturated 40 mM 5-HT stock solution was prepared by dissolving serotonin creatinine sulfate monohydrate (Sigma-Aldrich) in S-medium (67 ...
-
bioRxiv - Genomics 2021Quote: ... Treated sections were then mounted with hybridization buffer (5%/15% Formamide; 10% Dextran sulfate Sigma D8906; 0.02% BSA Ambion AM2616; 1 mg/ml E.coli tRNA Sigma R1753 ...
-
bioRxiv - Systems Biology 2022Quote: ... yeast were cultivated in or shifted to SD proline media (5 g/L potassium sulfate (Sigma-Aldrich: P0772), 1.7 g/L Yeast Nitrogen base (BD Biosciences ...
-
bioRxiv - Immunology 2023Quote: ... 2% FCS and 50 μg/ml Lipopolysaccharide neutralizing agent Polymyxin B sulfate (cat # 1405-20-5; Sigma-Aldrich) for 30 min at 37°C while shaking by 750 rpm on a heating block ...
-
bioRxiv - Cell Biology 2023Quote: ... for 5 min and hybridized with smFISH probes diluted 1:3000 in hybridization buffer (10% dextran sulfate, Sigma D8906 ...
-
bioRxiv - Genomics 2019Quote: ... and 3 × 10−5 mM hydrocortisone (Sigma H0888) in 6 well plates (Figure 1) ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 h with 5 µM cucurbitacin E (Sigma), 1 h with 50 µM CK666 (Bio-Techne ...
-
bioRxiv - Cell Biology 2021Quote: ... or HSF1 (sense strand: 5’-CGGAUUCAGGGAAGCAGCUGGUGCA-3’, Sigma) were used ...
-
bioRxiv - Cell Biology 2020Quote: ... or siRNA targeting Tim22 (5’ CCAUUGUGGGAGCCAUGUU 3’) (Sigma) or Tim29 (5’ GGCUCUUCGAUGAGAAGUA 3’ ...
-
bioRxiv - Microbiology 2023Quote: ... and the Uni12 primer (5’-AGCAAAAGCAGG-3’, Sigma). For mRNA analysis Oligo(dT ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: HMGB1 levels were measured using a commercial kit (HMGB1 ELISA kit A76696, Sigma-Aldrich). The assay was performed as described in the manufacturer’s protocol.
-
bioRxiv - Microbiology 2019Quote: ... rinsed worms were treated for 20 minutes with 100µL of a solution of SDS + DTT (WB + 0.25% v/v sodium dodecyl sulfate + 3% v/v dithiothreitol [1M, freshly mixed in water], chemicals from Sigma Aldrich) to partially disrupt the cuticle ...
-
bioRxiv - Biochemistry 2024Quote: ... DNA probes (5’-GTTATGAGCCCGACGAGCTACCAGGCTGCT-3’) with a 5’-ethylcarbamate amino linker (Sigma-Aldrich) were covalently immobilized on NHS-activated Sepharose 4 Fast Flow (GE Healthcare ...
-
bioRxiv - Cell Biology 2020Quote: ... The plate was blocked with 5% BSA (Sigma) in PBS for 3 hours at room temperature ...
-
bioRxiv - Cell Biology 2020Quote: ... 10% Dextran sulfate-500K (Sigma-Aldrich)) generating ∼40 ng/μl labeled DNA probe ...
-
bioRxiv - Cell Biology 2019Quote: ... 10% dextran sulfate (Sigma, D8906-50G) and 100× diluted murine RNase inhibitor in 2× SSC was prepared ...
-
bioRxiv - Molecular Biology 2020Quote: ... sodium dodecyl sulfate (Sigma-Aldrich 75746), magnesium chloride (Ajax Finechem 296) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 10% dextran sulfate (Sigma Aldrich, D6001) in 2xSSC and containing 125nM of RNA FISH probe sets against Sox2 labeled with Quasar 670 (Stellaris ...
-
bioRxiv - Cell Biology 2022Quote: ... 20μM serotonin creatinine sulfate monohydrate (Sigma), 2% tricaine ...
-
bioRxiv - Genetics 2019Quote: ... 1 mM N-acetyl cysteine (Sigma-Aldrich),10 μM zinc sulfate (Sigma-Aldrich) and 10 μg /ml of heparin sulfate ...
-
bioRxiv - Genetics 2019Quote: ... 10 μM zinc sulfate (Sigma-Aldrich) and 10 μg /ml of heparin sulfate ...
-
bioRxiv - Cancer Biology 2019Quote: ... copper (II) sulfate (1 mM, Sigma), and biotin-linker-azide—the linker functionalized with a TEV protease recognition sequence as well as an isotopically light or heavy valine for treatment of control or treated proteome ...
-
bioRxiv - Neuroscience 2019Quote: ... and 2µg/ml heparin sulfate (Sigma). Doxycycline (2µg/ml ...
-
bioRxiv - Bioengineering 2021Quote: ... sodium dodecyl sulfate (SDS, Sigma L3771), TritonX-100 detergent (Sigma X100) ...