Labshake search
Citations for Millipore Sigma :
251 - 300 of 10000+ citations for 5 Nitrofluorescein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... 5 mL of working solution of 5 volumes of Optiprep solution (Sigma, D1556) and one volume of diluent (150 mM KCl ...
-
bioRxiv - Cell Biology 2020Quote: ... Lipin-1 siRNA 5’-GAAUGGAAUGCCAGCUGAA-3’ and 3’-UUCAGCUGGCAUUCCAUUC-5’ (Invitrogen; HSS118307 (Sigma); optineurin siRNA (Invitrogen 4392420) ...
-
bioRxiv - Microbiology 2019Quote: ... for 5 min and permeabilized for 5 min with ice-cold methanol (Sigma). Cells were then washed with PBS and blocked with 5% horse serum for 30 min at RT ...
-
bioRxiv - Physiology 2019Quote: ... The membranes were blocked with 5 % nonfat dry milk or 5 % BSA (Sigma) for 1 h at room temperature and incubated with the antibodies described in the reagents section ...
-
bioRxiv - Microbiology 2021Quote: ... with each rNA 5 μg mixed with 5 μg poly(I:C) adjuvant (Sigma) and boosted with the same dose of rNA and poly(I:C ...
-
bioRxiv - Microbiology 2019Quote: ... and primers p181 (5’-GCGAAGATAACAGTGACTCTA-3’ and p54 (5’-CGGCTCTGATTAAATTCTGAAG-3’) (Sigma, UK).
-
bioRxiv - Microbiology 2021Quote: ... 5′5′-Tetramethylbenzidine (TMB) Liquid Substrate System for ELISA (Sigma-Aldrich, Taufkirchen, Germany) was added until a colour change was observed ...
-
bioRxiv - Microbiology 2021Quote: ... stock solutions of hemin (5 mM in 5 mM NaOH; 51280, Sigma-Aldrich) and riboflavin (500 μM in Milli-Q water ...
-
bioRxiv - Zoology 2019Quote: ... for 5 min and then blocked in 5% normal goat serum (Sigma-Aldrich) in PBS-T for 30 min ...
-
bioRxiv - Neuroscience 2019Quote: ... 5×103 cells were collected in a 5% Triton-X-100 (Sigma-Aldrich) in water solution and then prepared for RNA-seq as previously described (Nichterwitz et al. ...
-
bioRxiv - Cell Biology 2019Quote: ... sub-confluent cells were incubated for 5 min with 5-fluorouridine (FU) (Sigma). The cells were fixed in pure methanol at −20°C and processed for FU immunocytochemistry ...
-
bioRxiv - Microbiology 2022Quote: ... 5 µL of 5 mM nicotinamide 1,N6-ethenoadenine dinucleotide (εNAD, Sigma, N2630) solution was added to each well sample immediately prior to measurements and mixed by pipetting ...
-
bioRxiv - Molecular Biology 2023Quote: ... The compounds 5-aza-dC (5-Aza-2’-deoxycytidine, A3656, Sigma, Shanghai, China) and RG108 (N-phthalyl-L-tryptophan ...
-
bioRxiv - Plant Biology 2022Quote: Actinomycin D (ActD) and 5-fluorourasil (5-FU) were purchased from Sigma-Aldrich. Tunicamycin (Tm ...
-
bioRxiv - Cell Biology 2023Quote: – 5-iodo-2’-deoxyuridine (IdU) and 5-Chloro-2′-deoxyuridine (CldU) (Sigma-Aldrich) were dissolved in sterile DMEM at 2.5mM and 200mM respectively and stored at –20°C ...
-
bioRxiv - Genetics 2023Quote: ... 5 µl of 5 mM nicotinamide 1,N6-ethenoadenine dinucleotide (εNAD+, Sigma, N2630) solution was added to each well immediately before the beginning of measurements ...
-
bioRxiv - Biochemistry 2024Quote: ... DNA probes (5’-GTTATGAGCCCGACGAGCTACCAGGCTGCT-3’) with a 5’-ethylcarbamate amino linker (Sigma-Aldrich) were covalently immobilized on NHS-activated Sepharose 4 Fast Flow (GE Healthcare ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The cell lysates were transferred to a 96-well plate and reactions were initiated by adding 1 mM 5-thiobutyl butyrolactone (TBBL) and 1 mM 5′,5-dithiobis (2-nitrobenzoic acid) (DTNB) (Sigma Aldrich, D8130) in Pon2 activity assay buffer ...
-
bioRxiv - Immunology 2019Quote: ... inhibitors on the autophagic flux pathways (3-MA, 5 μM, Sigma-Aldrich; chloroquine, 5 μM, Sigma-Aldrich; bafilomycin, 5 μM, Sigma-Aldrich), and inhibitors on the mTOR pathway (Rapamycin ...
-
bioRxiv - Immunology 2019Quote: ... inhibitors on the autophagic flux pathways (3-MA, 5 μM, Sigma-Aldrich; chloroquine, 5 μM, Sigma-Aldrich; bafilomycin, 5 μM, Sigma-Aldrich), and inhibitors on the mTOR pathway (Rapamycin ...
-
bioRxiv - Cell Biology 2022Quote: ... Lipids were separated using a solvent mixture of triethylamine/chloroform/ethanol/water (5:5:5:1, v/v) (all solvents HPLC grade, Sigma-Aldrich, USA) as mobile phase in a solvent vapour saturated twin trough chamber (CAMAG ...
-
bioRxiv - Cell Biology 2023Quote: ... FAIK3-5 were treated with 1 µM of the hypomethylating agent 5-Azacytidine (5-Aza, Sigma-Aldrich, St. Louis, MO, United States) in an additional approach ...
-
bioRxiv - Neuroscience 2022Quote: To inject a dopamine transporter (DAT) inhibitor (GBR12909, D052, Sigma Aldrich, MO, 5 mg/ml in distilled water with 5% dimethyl sulfoxide, 67-68-5, Sigma Aldrich, MO) or vehicle (distilled water with 5% dimethyl sulfoxide) ...
-
bioRxiv - Pathology 2023Quote: ... The solvent (n=5) or an FXIa inhibitor (ONO-1600586, 3 µmol/L n=5) and mepacrine (Sigma-Aldrich; final concentration 5 µM) were added to the blood before perfusion ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-Vinculin (Vin-11-5) (1:5000; Sigma-Aldrich, SAB4200729, Vin-11-5), mouse anti-α-tubulin (B-5-1-2 ...
-
bioRxiv - Genomics 2019Quote: ... with primers 5’ GAGCTGGACGGCGACGTAAACG 3’ and 5’ CGCTTCTCGTTGGGGTCTTTGCT 3’ for amplification (Sigma-Aldrich, Germany). The PCR amplification was as follows ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μg human insulin mL-1 and 5×10-7 M hydrocortisone hemisuccinate (Sigma). Cells were seeded and expanded for two weeks and subsequently differentiated for another two weeks in the presence of 1.8% DMSO61 (dHepaRG).
-
bioRxiv - Microbiology 2020Quote: ... 5 μg human insulin mL−1 and 5×10−7 M hydrocortisone hemisuccinate (Sigma). As a control we generated HepaRG cells expressing an inactive HBx null mutant (HepaRG-HBxSTOP ...
-
bioRxiv - Cell Biology 2021Quote: ... 100 ng/μL NGF and 40 μM 5-UfDU (uridine and 5-fluorodeoxyuridine, Sigma). Cultures were maintained at 37°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... then treated with 1 uM of 5-Aza-2-deoxycytidine (5 –Aza, SIGMA, A3656) or PBS for 4 days ...
-
bioRxiv - Genetics 2022Quote: ... was diluted in molecular biology-grade water and 5-fluorouracil (5-FU) (Sigma-Aldrich) diluted in dimethyl sulfoxide (SigmaAldrich) ...
-
bioRxiv - Immunology 2022Quote: ... 5% CO2.with a mixture of 5 μg/mL polybrene (Sigma TR-1003-G) and pseudovirus diluted to a titer that produces 1*108 total integrated intensity units/mL ...
-
bioRxiv - Microbiology 2021Quote: ... media was supplemented with 50 mg L−1 5-aminolevulinic acid (5-ala, Sigma). When appropriate ...
-
bioRxiv - Microbiology 2021Quote: ... Top2β: Forward primer 5’CAGCCCGAAAGACCTAAATAC and reverse primer 5’ATCTAACCCATCTGAAGGAAC obtained from Sigma-Aldrich.
-
bioRxiv - Microbiology 2021Quote: ... and 5 g glucose) with 5 μl Penicillin-Streptomycin Stabilized solution (Sigma-Aldrich, P4458) and 24 μl of Amphotericin B solution (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μl of 5 mM Nicotinamide 1,N6-ethenoadenine dinucleotide (εNAD, Sigma cat # N2630) solution were added to each well immediately prior to the beginning of measurements and mixed by pipetting to reach a concentration of 500 μM in the 50 μl final volume reaction ...
-
bioRxiv - Cancer Biology 2022Quote: ... fish were incubated for 5 min with 5 mg.ml-1 adrenaline (epinephrine, Sigma, E4642) in order to contract the pigment in melanocytes prior mounting in LMP for imaging ...
-
bioRxiv - Neuroscience 2023Quote: ... the following 5-HTR antagonists were used: WAY100635 (W108, Sigma-Aldrich; for 5-HT1AR), GR55562 (cat# 1054 ...
-
bioRxiv - Bioengineering 2023Quote: ... 5-Aminolevulinic acid hydrochloride >98% (5-ALA) (Sigma Aldrich, St. Louis, Missouri, United States) was used for cell dosing alongside standard GBM media ...
-
bioRxiv - Biochemistry 2023Quote: ... Disodium salts of nucleoside-5’-monophosphates (5’-NMPdss) were purchased from Sigma-Aldrich (Bangalore). All other reagents were purchased from Sigma-Aldrich and were of alalytical grade.
-
bioRxiv - Neuroscience 2023Quote: ... 5 mM 2-amino-5-phosphonopentanoic acid and 100 U/ml DNase (DN25, Sigma) for 25 min ...
-
bioRxiv - Microbiology 2023Quote: ... low = 5 X 105 parasites) or concanamycin A (CON A) (5 μg/ml, Sigma); supernatants were harvested at 72 h ...
-
bioRxiv - Immunology 2023Quote: ... 5 ml of PBS and 5 ml of 4% Dextran (Sigma-Aldrich, 31392-50G) in PBS (Gibco ...
-
bioRxiv - Cell Biology 2022Quote: ... 5 μM diphenyleneiodonium chloride (DPI) (Millipore-Sigma, D2926, resuspended to 5 mM in DMSO) in Hanks Balanced Salt Solution (HBSS ...
-
bioRxiv - Cancer Biology 2023Quote: ... for 5 min and blocked in 5% FBS (Sigma Aldrich, cat. no. F7524-500ml), 0.1% Triton™ X-100 ...
-
Nucleolar Pol II interactome reveals TBPL1, PAF1, and Pol I at intergenic rDNA drive rRNA biogenesisbioRxiv - Molecular Biology 2023Quote: ... the cells were exposed to 1 mM 5-fluorouracil (5-FU; Sigma, Cat# F5130) for 15 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... Following concentration ranges were tested: 100–0.1 µM for 5-fluorouracil (5-FU, Sigma), alpelisib (Biozol ...
-
bioRxiv - Cell Biology 2024Quote: ... or pre-treated for 5 min and then incubated with 5 mM succinate (Sigma), or both in combination ...
-
bioRxiv - Microbiology 2024Quote: ... 5 µl of 5 mM nicotinamide 1,N6-ethenoadenine dinucleotide (εNAD+, Sigma cat# N2630) was added to each well immediately before measurements ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μg/mL Insulin (Sigma), 10 ng/mL EGF (Sigma) ...