Labshake search
Citations for Millipore Sigma :
2801 - 2850 of 10000+ citations for 6 Chloro 3 methyl 4 pyridinemethanol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... clone GS-6 (Millipore-Sigma #MAB302, 1:1000) at 4 °C overnight or rabbit anti-HA (Invitrogen #MA5-27915 ...
-
bioRxiv - Neuroscience 2023Quote: ... clone GS-6 (Millipore-Sigma #MAB302, 1:1000) at 4 °C overnight or rabbit anti-HA (Invitrogen #MA5-27915 ...
-
bioRxiv - Physiology 2024Quote: ... 2mM Sodium pyruvate (113-24-6, Sigma-Aldrich),1 µM dexamethasone (SC-29059 ...
-
bioRxiv - Genetics 2024Quote: ... Yeast Nitrogen Based 6 g/L (Sigma-Aldrich), agar 20 g/L (Sigma-Aldrich) ...
-
bioRxiv - Biochemistry 2024Quote: ... and 10 mM glucose-6-phosphate (G6P, Sigma) for 18 hours at 4 °C ...
-
bioRxiv - Systems Biology 2024Quote: ... /6% trifluoracetic acid (Sigma-Aldrich, HPLC grade, >99.9%), once with 1 mL 80% acetonitrile ...
-
bioRxiv - Systems Biology 2024Quote: ... Fisher Scientific)/6% trifluoracetic acid (Sigma-Aldrich, HPLC grade, >99.9%) prior to resuspending the sample in 1 mL 80% acetonitrile (Optima LC-MS grade ...
-
bioRxiv - Systems Biology 2024Quote: ... Fisher Scientific)/6% trifluoracetic acid (Sigma-Aldrich, HPLC grade, >99.9%) and vortexing the sample with the beads for 1 hour ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 4-OHT (Sigma) was dissolved in 100% ethanol (Sigma ...
-
bioRxiv - Neuroscience 2020Quote: ... 4% agarose (Sigma). Sagittal sections (50 μm thick ...
-
bioRxiv - Physiology 2021Quote: ... Exendin-4 (Sigma) was used at 50 nM at different time as indicated.
-
bioRxiv - Systems Biology 2020Quote: ... 4% paraformaldehyde (Sigma) in PBS was added to each well to a final concentration of 2% ...
-
bioRxiv - Cancer Biology 2021Quote: ... pH 4 (Sigma). Tumour size and mice weight were monitored three times per week and the experiment was stopped when the tumour size exceeded 1.44cm3 ...
-
bioRxiv - Cancer Biology 2022Quote: ... 4% paraformaldehyde (Sigma) was added to each well to fix cells and removed after 20 min incubation at RT ...
-
bioRxiv - Molecular Biology 2021Quote: ... 4-phenylenediamine (Sigma) and Mowiol 4-88 (Sigma) ...
-
bioRxiv - Cell Biology 2021Quote: ... 4-hydroxytamoxifen (Sigma), Biotin-phenol (Sigma).
-
bioRxiv - Cell Biology 2024Quote: ... 4-AP (Sigma) or CsCl (Sigma ...
-
bioRxiv - Cancer Biology 2021Quote: ... SMF cells and EMT6 cells were transduced at 50% confluency in 6-well plates with 1 mL of concentrated lentivirus and 6 µg/mL polybrene (Sigma 107689) at 1000xg and 33°C for 2 hours ...
-
bioRxiv - Neuroscience 2021Quote: ... the electrode surfaces of 6-well Axion plates (Axion Biosystems, CytoView MEA 6) were coated with 10 mg/mL poly-D-lysine (Sigma, P7280) at room temperature overnight ...
-
bioRxiv - Microbiology 2021Quote: ... Cell pellets were resuspended in 6 mL of cold water and lysed by adding them dropwise to 6 mL of boiling 8% SDS (Sigma-Aldrich) within 10 min ...
-
bioRxiv - Microbiology 2022Quote: ... the msfGFP levels were normalized for OD600 and converted to absolute units using 5(6)-carboxyfluorescein (5(6)-FAM) (Sigma Aldrich) as a calibrant (36 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Cells were cultured on Greiner Bio-One CELLSTAR Polystyrene 6-well Cell Culture Multiwell Plates coated first with Poly-L-ornithine hydrobromide (6 μg/mL in 1xPBS (Sigma-Aldrich), 1 h at 37℃ ...
-
bioRxiv - Microbiology 2023Quote: ... The relative msfGFP measurements were normalised for their respective OD600 values and subsequently converted to absolute units of the calibrant 5(6)-carboxyfluorescein (5(6)-FAM)) (Sigma-Aldrich). Finally ...
-
bioRxiv - Neuroscience 2024Quote: ... 500’000 cells per well were seeded as single cells onto new 6-well plates (6 WPs) coated with vitronectin and cultured in mTESR+ medium supplemented with thiazovivin (SML1045, Sigma Aldrich). 2 μL of each viral construct (TetO-Ngn2-P2A-puromycin ...
-
bioRxiv - Cancer Biology 2021Quote: ... Samples were reconstituted in 50 μL dry pyridine and 50 μL N-Methyl-N-(trimethylsilyl) trifluoroacetamide (MSTFA, Sigma Aldrich, St Louis, MI, USA) silylation agent added ...
-
bioRxiv - Molecular Biology 2021Quote: ... The fatty acids were identified by comparison of the retention times of a standard solution of 37 fatty acid methyl esters (Sigma; 47885-U Supelco) in GC-FID and confirmed by high accuracy mass of molecular ions and their fragments after injection into a GC-MS (Q-Exactive™ ...
-
bioRxiv - Cancer Biology 2022Quote: Cells were harvested and lysed in NP-40 buffer containing phenyl methyl sulfonyl fluoride and Protease Inhibitor Cocktail (Sigma, St. Louis, MO, USA). Protein expression was studied by exposing the membranes to antibodies against AR (Abcam ...
-
bioRxiv - Cell Biology 2022Quote: ... The beads were then washed 3x times with ribosome binding buffer and bound mannosylated molecules were eluted with ribosome binding buffer containing 200mM methyl-α-D-mannopyranoside (Sigma-Aldrich, M6882). The eluted fractions were then subjected to SDS-PAGE and immunoblotting with antibodies.
-
bioRxiv - Neuroscience 2022Quote: ... the workflow of this assay involves four main steps: (i) Tissue is harvested and lysed in lysis buffer containing S-Methyl Methanethiosulfonate (MMTS, Sigma, Cat no. 64306) to block free thiol groups (-SH) ...
-
bioRxiv - Biochemistry 2024Quote: ... The solvent was evaporated under a stream of nitrogen before adding 5 ml of a 5 mM (6.55 mg/ml) solution of methyl-β-cyclodextrin (Sigma 332615, Mn∼1310) prepared in Buffer A ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were treated with cholesterol (3β-hydroxy-5-cholestene, Sigma-Aldrich, C-3045; cholesterol–methyl-β-cyclodextrin, Sigma-Aldrich, C-4951, Missouri, USA), IL1β (GenScript ...
-
bioRxiv - Immunology 2024Quote: ... Bp was transferred to Stainer-Scholte medium supplemented with 1mg/ml (2,3,6-tri-O-methyl)-β-cyclodextrin Heptakis (Sigma-Aldrich, Cat. H0513-5G) and incubated in a rolling drum at 180 rpm at 37°C for 24 hours ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2.5mM of L-NAME (Nω-Nitro-L-arginine methyl ester hydrochloride) was added to cell cultures (Sigma, St. Louis, MO, USA, Cat. # N5751). L-arginine ...
-
bioRxiv - Plant Biology 2020Quote: ... and histidine but supplemented with 2.5 mM 3-AT (3-Amino-1,2,4-triazole; Sigma) for 4 days at 28°C.
-
bioRxiv - Genomics 2019Quote: ... with primers 5’ GAGCTGGACGGCGACGTAAACG 3’ and 5’ CGCTTCTCGTTGGGGTCTTTGCT 3’ for amplification (Sigma-Aldrich, Germany). The PCR amplification was as follows ...
-
bioRxiv - Cell Biology 2019Quote: ... washed 3 times in PBS before incubation in PBS supplemented with 3% BSA (Sigma) for 30 min to block non-specific antibody binding ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.12 g (6.25 mmol) of 1-ethyl-3-(3-dimethyllaminopropyl) carbodiimide HCl (Sigma Aldrich) was added to the flask containing 0.98 g (2.7 mmol ...
-
bioRxiv - Plant Biology 2020Quote: ... (±)-3-Hydroxydecanoic acid (3-OH-C10:0) and chitin were obtained from Sigma-Aldrich. All elicitors were dissolved in deionized MilliQ sterile water at the respective stock concentration of 1mM for flg22Pa ...
-
bioRxiv - Neuroscience 2021Quote: ... histone 3 lysine 27 tri-methylation (H3K27me3) and histone 3 antibodies (all from Millipore). Positive bands were detected by chemiluminescent reagents (Thermofisher ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 3-uncoupled (3U) after sequential addition of 3 mM ADP (Sigma-Aldrich A5285), 4 μM oligomycin (Sigma-Aldrich C75351) ...
-
bioRxiv - Immunology 2022Quote: ... containing 0.25% with 3-[(3-cholamidopropyl) dimethylammonio]-1-propanesulfonate (CHAPS) (Sigma, St. Louis, MO) for two minutes at 37°C ...
-
bioRxiv - Developmental Biology 2023Quote: ... and (3) 3 hrs at RT in 0.1% Direct Red 23 (212490, Sigma-Aldrich), in PBST ...
-
bioRxiv - Neuroscience 2023Quote: ... Two pulse applications of 3 µM of GSK-3 Inhibitor CHIR99021 (Merck Millipore, 361571) were done on days 13 and 14 ...
-
bioRxiv - Biochemistry 2023Quote: ... and eluted with Cas1-2/3 Lysis Buffer containing 3 mM desthiobiotin (Sigma-Aldrich). Eluate was concentrated at 4°C (Corning Spin-X concentrators) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 98% EDC [1-(3-Dimethylaminopropyl)-3-ethyl carbodiimide hydrochloride] were purchased from Sigma Aldrich. SYBR Safe nucleic acid gel staining dye was obtained from Invitrogen (Fisher Scientific ...
-
bioRxiv - Developmental Biology 2022Quote: ... Two pulse applications of 3 μM of GSK-3 Inhibitor CHIR99021 (Merck Millipore, 361571) were done on days 13 and 14 ...
-
bioRxiv - Neuroscience 2020Quote: ... the tamoxifen active metabolite 4-hydroxytamoxifen (4-OHT, Sigma, cat#H6278) was used instead of tamoxifen ...
-
bioRxiv - Molecular Biology 2021Quote: ... and subsequently fixed overnight at 4°C in 4% paraformaldehyde (Sigma). Next ...
-
bioRxiv - Biophysics 2021Quote: ... 4 cm by 4 cm in chloroform (Sigma Aldrich, analytical standard) and placed the piece of paper inside the plastic container with the recorded fungal substrate.
-
bioRxiv - Cancer Biology 2021Quote: ... cells were treated with 1μM 4-hydroxy tamoxifen (4-OHT) (Sigma) for 48h ...