Labshake search
Citations for Millipore Sigma :
2751 - 2800 of 10000+ citations for Mouse IgG2a Isotype Control Antibody Biotin 15H6 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... Control samples with an additional 100 μM EDTA (Sigma) or without Fenton reagents were treated in the same way ...
-
bioRxiv - Immunology 2019Quote: ... RGD peptide or as control GRADSP (RAD) peptide (SIGMA) was injected via Wharton’s duct cannulation (approximately 600 nmol of either peptide in 30 µl per lobe in PBS) ...
-
bioRxiv - Cell Biology 2020Quote: ... and the protein loading control tubulin (Merck, Sigma-Aldrich). Immuno-reactive complexes were detected using HRP-conjugated secondary antibodies (Cell Signaling Technology ...
-
bioRxiv - Cell Biology 2021Quote: ... Controls used were Empty vector and Mission (CAACAAGATGAAGAGCACCAA) (Sigma).
-
bioRxiv - Genetics 2019Quote: ... The control treatment contained 5ug/uL puromycin (SIGMA-ALDRICH, puromycin dihydrochloride from Streptomyces alboniger (P7255) ...
-
bioRxiv - Immunology 2021Quote: ... Control cells were treated with non-targeting siRNA (Sigma).
-
bioRxiv - Immunology 2021Quote: ... pLKO.1-puro eGFP shRNA control (Plasmid SHC005; Sigma) produced by packaging line HEK293FT ...
-
The G2-phase enriched lncRNA SNHG26 is necessary for proper cell cycle progression and proliferationbioRxiv - Molecular Biology 2021Quote: ... MISSION® siRNA Universal Negative Control #1 (Sigma, SIC001) and Negative control B Antisense LNA GapmeR (Qiagen ...
-
bioRxiv - Immunology 2021Quote: ... PHA (Sigma-Aldrich; positive control at 5 μg/ml) or RPMI (negative control) ...
-
bioRxiv - Genetics 2020Quote: ... 15N-labelled uridine (internal control, previously dephosphorylated; Sigma Aldrich) in 0.1% formic acid was added to each reaction and this was subsequently prepared for LC-MS-MS by filtration through 30 kDa molecular weight cut-o filters (Sigma).
-
bioRxiv - Neuroscience 2020Quote: ... and negative control MS094 (Millipore-Sigma, Burlington, MA, USA) were purchased and stored at −20°C prior to and following reconstitution ...
-
bioRxiv - Cancer Biology 2020Quote: ... The scrambled control siRNA (SIC002) was ordered from Sigma.
-
bioRxiv - Molecular Biology 2022Quote: ... and GAPDH (cytoplasmic control: Sigma-Aldrich, Cat.-No. HPA040067) were additionally analysed (Figure 1B ...
-
bioRxiv - Cancer Biology 2022Quote: ... or a nontargeting control sequence (Scramble; Millipore Sigma, SHC002) in a pLKO.1 vector were used to disrupt the expression of proteins associated with Fe-S cluster homeostasis ...
-
bioRxiv - Neuroscience 2022Quote: ... A control group received vehicle solution (0.9% NaCl; Sigma). Mice treated with MPTP ...
-
bioRxiv - Plant Biology 2022Quote: ... α-ACTIN-2 as loading control (A0480, Sigma-Aldrich), 1:10000 ...
-
bioRxiv - Plant Biology 2023Quote: ... Rubisco loading control was stained using Ponceau S (Sigma).
-
β-catenin programs a tissue-specific epigenetic vulnerability in aggressive adrenocortical carcinomabioRxiv - Cancer Biology 2022Quote: ... negative control IgG (EMD Millipore, Cat. No. 12-370). Co-IPs were evaluated by mass spectrometry (IP-MS) ...
-
bioRxiv - Physiology 2023Quote: ... and control siRNA (sense: CGUACGCGGAAUACUUCGA; antisense: UCGAAGUAUUCCGCGUACG, Sigma-Aldrich)19 were used at a final concentration of 50nM ...
-
bioRxiv - Cancer Biology 2024Quote: ... Dock7 shRNAs and negative control were purchased from Sigma (shRNA1 ...
-
bioRxiv - Cell Biology 2023Quote: ... with scrambled control or GCN5L1 shRNA (Sigma-Aldrich, USA), or control or GCN5L1 ORF lentiviral particles (Origene ...
-
bioRxiv - Molecular Biology 2023Quote: ... As loading control ACTIN (1:500, Sigma, Cat#A5441), TUBULIN (1:500 ...
-
bioRxiv - Cancer Biology 2023Quote: ... or a negative control siRNA (si-Con; Sigma-Aldrich) using Lipofectamine RNAmax (ThermoFisher) ...
-
bioRxiv - Cell Biology 2023Quote: ... or negative control IgG (Sigma-Aldrich; #I5006; 5 μg). Then ...
-
bioRxiv - Microbiology 2023Quote: ... We included controls with the solvent DMSO (Sigma-Aldrich), of which the concentration was kept constant in all treatments ...
-
bioRxiv - Cell Biology 2023Quote: ... or positive control TGF-β1 10ng/ml (Sigma, T7039) for 3 days in fresh medium (without FBS due to assay interference) ...
-
bioRxiv - Bioengineering 2023Quote: ... or 9 mM methyl acetate vehicle control (Sigma Aldrich) every 48 hours ...
-
bioRxiv - Cell Biology 2023Quote: ... or non-targeting control sgRNA (Millipore Sigma, CRISPR20-1EA) was obtained through transfecting HEK293T cells with these plasmids in combination with a second generation CMV lentiviral packaging system and FuGENE transfection agent (E2311 ...
-
bioRxiv - Biochemistry 2023Quote: ... The control siRNA (siCTL) was purchased from Sigma-Aldrich (MISSION siRNA Universal Negative Control#1) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... The control group was set with 0.1% DMSO (Sigma), and the blank control was set with water ...
-
bioRxiv - Cell Biology 2023Quote: ... or siRNA Universal Negative Control (Cat. SIC001, Millipore Sigma) per 2.7 x 105 hiPSC-CMs 5 days post plating using Mission® siRNA Transfection Reagent (Cat ...
-
bioRxiv - Cell Biology 2023Quote: ... and MISSION® siRNA Universal Negative Control #1 (Sigma) was used as a negative control.
-
bioRxiv - Plant Biology 2023Quote: ... Rubisco loading control was stained using Ponceau S (Sigma) or Ponceau 4R (Irn Bru ...
-
bioRxiv - Cell Biology 2023Quote: ... The negative control siRNA was purchased from Sigma-Aldrich (MISSION siRNA Universal Negative Control ...
-
bioRxiv - Cancer Biology 2024Quote: ... or 9 mM methyl acetate vehicle control (Sigma Aldrich) every 48 hours.
-
bioRxiv - Plant Biology 2024Quote: ... Rubisco loading control was stained using Ponceau S (Sigma) or Ponceau 4R (AG Barr).
-
bioRxiv - Cell Biology 2024Quote: ... Control fluorescent scRNA (SIC005) was purchased from Sigma-Aldrich. Transfection of siRNA was performed according to the specifications recommended by the manufacturer using a commercial transfection reagent (sc-29528 ...
-
bioRxiv - Cell Biology 2021Quote: ... The membrane was then incubated with the corresponding Alexa Fluor 647-conjugated secondary antibody or Alexa Fluor 555-conjugated anti-mouse IgG1 secondary antibody (Sigma-Aldrich, SAB4600301-50UL) at RT for 1 hour followed by 3 additional wash with TBST buffer ...
-
bioRxiv - Cancer Biology 2020Quote: ... Immunoblotting for specific proteins was carried out using the following primary antibodies: Mouse monoclonal antibodies against anti-FLAG M2 (Millipore Sigma, Billerica, MA), Jak1 (CST-50996) ...
-
bioRxiv - Genetics 2022Quote: ... in PBS and incubated with rabbit polyclonal vault antibodies (N2-B15, provided by Leonard Rome, dilution 1:1000) and mouse anti-NeuN antibodies (MAB377, Millipore, dilution 1:1000) in 0.1%NDS/PBS at 4 °C overnight under agitation ...
-
bioRxiv - Microbiology 2022Quote: ... for 1 h and incubated with the rabbit monoclonal anti-HA antibody (CST, 3724, 1:500) or mouse monoclonal anti-Flag antibody (Sigma, F3165, 1:100) overnight at 4°C ...
-
bioRxiv - Cell Biology 2019Quote: Antibodies used in immunofluorescence and Western blot include: anti-MMP9 rabbit polyclonal antibody (# AB13458) and anti-GAPDH mouse monoclonal antibody (# CB1001) purchased from EMD Millipore (Billerica, MA); anti-Src rabbit antibody (# 2108) ...
-
bioRxiv - Cell Biology 2020Quote: ... incubated in mouse anti-Pax7 antibody (undiluted, Antibody Registry ID: AB_528428) and rabbit anti-laminin (1:250, #L9393,Sigma-Aldrich, St. Louis, MO) overnight at 4°C ...
-
bioRxiv - Neuroscience 2021Quote: ... Primary antibody incubation was carried out at 4°C overnight with the following antibodies: mouse anti-Calbindin-D-28K (Sigma, C9848, 1:1000), rabbit anti-vGlut2 (Synaptic Systems ...
-
bioRxiv - Cell Biology 2022Quote: ... Membranes were also probed with either a mouse monoclonal antibody against GAPDH or a mouse monoclonal antibody against beta-actin (dilutions of 1:10,000 and 1:1000; Sigma-Aldrich/Merck group, USA) and with the IRDye® 680CW secondary antibody from Eurobio Ingen (926-32220 ...
-
bioRxiv - Microbiology 2022Quote: ... cells were incubated overnight at 4 °C with 1:500 rabbit anti-ACP antibody (Gallagher & Prigge, 2010) and 1:500 mouse anti-FLAG antibody (Catalogue no. F3165, Millipore Sigma, MO, USA). The cells were washed with PBS three times and then incubated for 2 h with 1:1000 goat anti-mouse Alexa 488 (Catalogue no ...
-
MK2 deficiency decreases mortality during the inflammatory phase after myocardial infarction in micebioRxiv - Physiology 2023Quote: ... The primary antibodies used were a mouse monoclonal antibody against smooth muscle α-actin (α-SMA, a myofibroblast marker; A-2547, Sigma-Aldrich) and rabbit polyclonal antibodies against myeloperoxidase (MPO ...
-
bioRxiv - Neuroscience 2023Quote: ... The sections were then incubated with GFAP antibody (mouse anti-GFAP; 3670S; 1:1000; CST, Danvers, MA) and TH antibody (sheep anti-TH; 1:1000; AB1542; Millipore Sigma, Burlington, MA) together at 4°C for 18 hours followed by appropriate secondary antibodies (donkey anti-mouse IgG [H+L] ...
-
bioRxiv - Microbiology 2023Quote: ... overnight at 4 °C following incubation with mouse anti-rAgApyrase antibody (1:10,000 in blocking buffer) or rabbit anti-tPA antibodies (1:2500) (Millipore-Sigma, Marlborough, MA, USA). Membranes were incubated with anti-mouse or anti-rabbit horseradish peroxidase (1:2500 in blocking buffer ...
-
bioRxiv - Developmental Biology 2024Quote: Single and double immunohistochemical reactions were performed as described previously (59) using the following primary antibodies: mouse antibody to parvalbumin (Sigma, P3088; 1:750), mouse antibody to SatB2 (Abcam ...