Labshake search
Citations for Millipore Sigma :
2751 - 2800 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... 100μg/ml Cholera toxin (Sigma-Aldrich C8052), and 10mg/ml Insulin (Sigma-Aldrich I0516) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The linear DNA backbone was then extracted from the gel via electroelution in D-tubes (EMD Millipore 71508-3), followed by phenol chloroform extraction and butanol concentration.
-
bioRxiv - Molecular Biology 2024Quote: ... and 10mg/ml Insulin (Sigma-Aldrich I0516). 293T cells (ATCC CRL-3216 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Lysate was diluted 1:5 in IP buffer (16.7 mM Tris-HCl pH 8.1, 1.2 mM EDTA, 167 mM NaCl, 1% Triton X-100 and 1X protease inhibitor cocktail [Sigma; P8340]) and pre-cleared with 50 µL protein G Dynabeads (ThermoFisher ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA isolation was done using Trizol (Millipore Sigma, catalogue #T9424). Isolated RNA was run on UREA-PAGE ...
-
bioRxiv - Molecular Biology 2024Quote: ... Anti-FLAG (Millipore Sigma, catalogue #F1804) antibody was used at 1:10000 dilution in 1% [w/v] bovine serum albumin supplemented PBST ...
-
bioRxiv - Molecular Biology 2024Quote: Trizol (Millipore Sigma, catalogue: T9424) was used to extract total RNA from frozen worm pellets or beads after immunoprecipitation ...
-
bioRxiv - Neuroscience 2024Quote: ... mouse monoclonal antibody against NeuN (1:1,000; Cat# MAB377, RRID: AB_2298772, Millipore, MA, USA), mouse monoclonal antibody against tyrosine hydroxylase (1:2,000 ...
-
bioRxiv - Neuroscience 2024Quote: ... the brain slices were washed and mounted in Fluoromount (Sigma). Confocal images were taken with the LSM800.
-
bioRxiv - Neuroscience 2024Quote: ... rabbit anti-GABA (1:1000, Sigma, Cat#A2052), rabbit anti-MCH (1:20000 ...
-
bioRxiv - Molecular Biology 2024Quote: ... The IPed ALG-1 was then washed with slicing buffer (30mM HEPES [pH 7.4], 40mM Potassium Acetate, 5mM Magnesium Acetate, 5mM DTT, phosphatase inhibitor (Sigma, catalogue #4906845001)) ...
-
bioRxiv - Molecular Biology 2024Quote: ... an anti-VGlut2 antibody (Sigma-Aldrich, 1:100), an anti-PGP9.5 antibody (NOVUS ...
-
bioRxiv - Molecular Biology 2024Quote: ... we used anti-FLAG M2 magnetic beads (Millipore Sigma, catalogue #M8823) directly.
-
bioRxiv - Molecular Biology 2024Quote: ... and an anti-CCK8 antibody (Sigma-Aldrich, 1:500). After this ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 0.026% w/v trypsin inhibitor (Sigma-Aldrich, T9003) and centrifuged at 300 x g for 3 minutes ...
-
bioRxiv - Molecular Biology 2024Quote: ... anti-FLAG epitope tag (L00018; Sigma), Rabbit polyclonal anti-SARS-CoV-2 nucleoprotein N protein (40068-RP01 ...
-
bioRxiv - Molecular Biology 2024Quote: 10 μM VP 1394 oligonucleotides (ACGATTAACCCTGATACCAA) were phosphorylated with 1mM ATP (Sigma) and 10 units PNK (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... for differentiation induction 100.000 cells were plated in a 6-well plate and maintained in complete media supplemented with 20μM retinoic acid (Sigma-Aldrich, R2625) in dimethyl sulfoxide (DMSO ...
-
bioRxiv - Molecular Biology 2024Quote: ... Tamoxifen (Sigma-Aldrich, T5648) was resuspended in 90% corn oil (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2024Quote: ... Nickel-3,3’-diaminobenzidine (Ni-DAB) solution (0.175M Sodium acetate, 1% Nickel ammonium sulphate, 50mg DAB (Sigma-Aldrich, D-5905)) with 0.075 % H202 was used to develop the colour for 6 min stopping the reaction by washing the sections 2 x 5 min in dH2O ...
-
bioRxiv - Molecular Biology 2024Quote: ... was resuspended in 90% corn oil (Sigma-Aldrich, C8267) and 10% pure ethanol and dissolved at 56°C for 30 minutes in the dark ...
-
bioRxiv - Molecular Biology 2024Quote: ... Sections were then rehydrated with phosphate-buffered saline (PBS) pH 7.4 for 10 min and PBS with 0.05% Tween-20 (PBST) (Sigma-Aldrich) for 5 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... In the tMCAO study the brains were cut in 6 coronal sections and stained with 1% 2,3,5-Triphenyltetrazolium Chloride (TTC) (Sigma-Aldrich) in PBS solution for 5 minutes at 37 °C in agitation before dissection of contralateral and peri-ischemic cortical regions ...
-
bioRxiv - Molecular Biology 2024Quote: ... the cells were treated with 10 μg/mL cycloheximide (CHX, #C7698, Sigma) for apoptosis induction ...
-
bioRxiv - Microbiology 2024Quote: ... Immunoblotting was performed using mouse anti-FLAG M2 (Sigma-Aldrich), rabbit anti-Actin (Bethyl) ...
-
bioRxiv - Microbiology 2024Quote: ... or etoposide (Sigma). U2OS cells were permeabilized with 0.5% Triton X-100 in PBS at 4°C for 5 min and fixed in 4% PFA for 20 min ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were then selected using 2 µg/ml puromycin (Sigma-Aldrich; P8833). NR2F1 knockout was confirmed by Western blot ...
-
bioRxiv - Cancer Biology 2024Quote: ... CD81 (Sigma Millipore, MABf2061), anti-p21 (Proteintech Group Inc ...
-
bioRxiv - Cancer Biology 2024Quote: ... and anti-α-tubulin (Sigma Millipore, ABT170).
-
bioRxiv - Cancer Biology 2024Quote: ... the medium was concentrated using Amicon Ultra Centrifugal Filter Units with a 100-kDa MW cutoff (Sigma), transferred to thick wall polypropylene tubes (Beckman Coulter) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Other reagents were also used: Poly-L-Lysine (Millipore Sigma, P4832); EasyPep Mini MS sample prep Kit (Thermoscientific ...
-
bioRxiv - Cancer Biology 2024Quote: ... anti-p62 (Sigma Millipore, P0067), anti-Rab7 (Cell Signaling ...
-
bioRxiv - Cancer Biology 2024Quote: ... and anti-α-tubulin (Sigma Millipore, ABT170).
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were then permeabilised in 0.2% Triton X-1000 (Sigma #X100) for 3 minutes and re-suspended in 0.5x PBS with 5% DMSO and frozen at -80°C until the SIGNAL-seq barcoding process was performed as described below ...
-
bioRxiv - Cancer Biology 2024Quote: ... 11-to 12-week-old mice were treated with 5mg of Tamoxifen (T5648; Millipore-Sigma, St Louis, MO) via oral gavage ...
-
bioRxiv - Cancer Biology 2024Quote: ... barcode set in suspension using identical concentrations for 2 hours at room temperature before 2x washes with GSH-CSB (1 mM Gulutathione (Sigma #G6529)) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 10 nM Gastrin I (Sigma #SCP0152), 10 mM Nicotinamide (Sigma #N0636) ...
-
bioRxiv - Cancer Biology 2024Quote: ... cells were washed with PBS and 3-(4,5-dimethyl-2-thiazolyl)2,5-diphenyl-2-H-tetrazolium bromide (MTT, Sigma-Aldrich) solution (final concentration ...
-
bioRxiv - Cancer Biology 2024Quote: ... supplemented with 2 mM L-Glutamine (Sigma #G7513) and 10% FBS (Pan-Biotech #P30-8500) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 10 mM Nicotinamide (Sigma #N0636), and 1X HyClone Penicillin-Streptomycin Solution (Fisher #SV30010) ...
-
bioRxiv - Cancer Biology 2024Quote: ... After starvation HeLa spheroids were pre-treated with a combination of inhibitors for 10 minutes before growth factor treatment: 100 nM Trametinib (Cayman #16292) and 500 nM GDC0941 Pictilisib (SelleckChem #S186513) or vehicle (DMSO Sigma #D2650). After inhibitor treatment spheroids were treated with a combination of growth factors or vehicle for 30 minutes before fixation in-situ ...
-
bioRxiv - Cancer Biology 2024Quote: ... anti-TH (1:200, Millipore), anti-E-cadherin (1:200 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 10 mM HEPES (Sigma #H3375), 500 nM A83-01 (Generon #04-0014) ...
-
bioRxiv - Cancer Biology 2024Quote: ... The following primary antibodies were used: anti-CGRP (1:200, Abcam, Sigma-Aldrich), anti-VAChT (1:200 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1 mM N-acetyl-L-cysteine (Sigma #A9165), 10 mM HEPES (Sigma #H3375) ...
-
bioRxiv - Cancer Biology 2024Quote: ... or fibronectin (10µg/mL, Sigma F2006) for 1 hour at room temperature ...
-
bioRxiv - Cancer Biology 2024Quote: MDA-MB-231 (HTB-26; ATCC) were cultured in Dulbecco’s modified Eagle’s medium (DMEM; D5796; Sigma Aldrich) supplemented with 10% foetal bovine serum (FBS ...
-
bioRxiv - Cancer Biology 2024Quote: ... and resuspended in Guava Cell Cycle Staining Reagent (Millipore). Data acquisition was performed on a Guava PCA-96 system (Millipore) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5 μM ALK inhibitor (A83-01, Sigma-Aldrich, Saint Louis, MO, USA), 5 μM GSK3 inhibitor (CHIR99021 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5 μM GSK3 inhibitor (CHIR99021, Sigma-Aldrich), and 10 μM ROCK inhibitor (Y27632 ...