Labshake search
Citations for Millipore Sigma :
2701 - 2750 of 10000+ citations for Tetratricopeptide Repeat Protein 5 TTC5 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... Biotinylated hyaluronic acid binding protein (Millipore) was used at 10 μg/mL ...
-
bioRxiv - Developmental Biology 2023Quote: ... or protein A-agarose beads (Sigma) for 2-3 hours at 4℃ ...
-
bioRxiv - Developmental Biology 2024Quote: ... EZView protein G affinity beads (Sigma) were washed with lysis buffer A 3x times ...
-
bioRxiv - Neuroscience 2024Quote: ... protein kinase C (Sigma-Aldrich; P5704), ACSL4 (Abgent ...
-
bioRxiv - Developmental Biology 2024Quote: ... EZView protein G affinity beads (Sigma) were washed with lysis buffer A 3x ...
-
bioRxiv - Molecular Biology 2024Quote: ... protein inhibitor cocktail (539134, Millipore Sigma), sodium fluoride ...
-
bioRxiv - Molecular Biology 2024Quote: ... and protein extraction with BugBuster (Novagen), the target tag-SLO protein underwent Ni2+-IMAC resin (Bio-Rad ...
-
bioRxiv - Molecular Biology 2022Quote: ... For secondary antibodies anti-mouse antibody (Sigma-Aldrich), anti-rabbit (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2024Quote: ... Antibodies were anti-α-tubulin antibody (Sigma-Aldrich, T6199 ...
-
bioRxiv - Microbiology 2023Quote: ... or FLAG antibody (Sigma Monoclonal FLAG antibody M2) in TBST with 5% NFDM (w/v) ...
-
bioRxiv - Cancer Biology 2022Quote: ... protein were combined with a mixture of 50 % (v/v) protein A and 50 % (v/v) protein G beads (Sigma-Aldrich Inc., Cat#P9424 and Cat#P3296) and 0.5-1 μg antibody in lysis buffer overnight at 4 °C ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-α-tubulin (B-5-1-2) (1:10000; Sigma-Aldrich T5168, B-5-1-2), mouse anti-GAPDH (1:25000 ...
-
bioRxiv - Physiology 2022Quote: ... Membranes were blocked for 1 hour at room temperature in 5% milk or 5% BSA (Millipore Sigma) in 1X Tris-buffered saline + 0.1% Tween 20 (TBST) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The rANF single strands DNAs (5’-AGAGGTCATGAAGGACATT-3’ and 5’AATGTCCTTCATGACCTCT-3’) were purchased from Sigma Aldrich and annealed ...
-
bioRxiv - Molecular Biology 2021Quote: A CU RNA hairpin (5’-AAAAGAAAAGACGCGUAGUUUUCUACGCG- 3’) labeled with Cyanine 5.5 at the 5’-end (Millipore Sigma) was annealed in 20 mM HEPES ...
-
bioRxiv - Biochemistry 2019Quote: Clindamycin [CAS: 21462-39-5] and 5-fluorouracil [CAS: 51-21-8] were purchased from Sigma-Aldrich, St ...
-
bioRxiv - Cancer Biology 2021Quote: T-HEp3 cells (P1) growing in a dish were treated with 5 nM 5-Azacytidine (Sigma #A2385) in DMEM containing charcoal-stripped 10% FBS ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 mM β-mercaptoethanol and incubated for 5 min with 2 mM ATPγS (lithium salt, Sigma Aldrich). 4 µL of this mixture were then applied to the plasma-cleaned grids ...
-
bioRxiv - Neuroscience 2020Quote: ... Trim28-fl(+/− and +/+) animals (Ctl n=5, KO n=5) were put in RIPA buffer (Sigma-Aldrich) containing Protease inhibitor cocktail (PIC ...
-
bioRxiv - Molecular Biology 2021Quote: ... Selected sections were incubated with 5 mg/ml α-amylase for 5 minutes at 37 °C (Sigma) to confirm distinct glycogen and glycoprotein stain localization ...
-
bioRxiv - Biochemistry 2020Quote: ... P4 5’ CTTGTCGTCATCGTCTTTGTAGTCCTTGTC 3’ and P5 5’ CAGGAAACA GCTATGACCATG 3’ and KOD Hot Start DNA Polymerase (Millipore).
-
bioRxiv - Evolutionary Biology 2020Quote: ... guanosine-15N5 5′-monophosphate (Cat #900380) and guanosine-13C10 5′-triphosphate (Cat #710687) were purchased from Sigma-Adrich (St ...
-
bioRxiv - Microbiology 2021Quote: ... were plated on synthetic complete (SC) plates containing 1□mg/ml 5-FOA (5-fluorotic acid; Sigma) and on non-selective SC plates/ ...
-
bioRxiv - Cell Biology 2021Quote: ... the 3’UTR of Polη (5’GCAAUGAGGGCCUUGAACA3’ from sigma-Aldrich) and Rev1 (5’CAGCGCAUCUGUGCCAAAGAA3’ from Sigma-Aldrich). For control ...
-
bioRxiv - Cell Biology 2021Quote: ... Membranes were blocked using 5% non-fat dry milk or 5% bovine serum albumin (BSA) (Sigma-Aldrich) for phosphorylated proteins immunoblots in Tris-buffered saline (TBS ...
-
bioRxiv - Cell Biology 2021Quote: ... CEP192 knockdown was achieved by transfecting the oligo duplex: 5’-GGAAGACAUUUUCAUCUCUtt-3’ and 5’-AGAGAUGAAAAUGUCUUCCtt-3’ (Sigma).
-
bioRxiv - Biochemistry 2022Quote: ... The [5′-32P] cytidine 3′,5′-bisphosphate was prepared by incubating 1 mM cytidine 3′-monophosphate (Sigma) with 312.5 pmole [γ-32P] ATP (6000 Ci/mmol ...
-
bioRxiv - Genetics 2022Quote: ... The membrane was hybridized with 5 pmol/ml of a 5’ DIG-labeled (AGAGGG)10 probe (Sigma) in DIG Easy Hybridization Solution (Sigma ...
-
bioRxiv - Biochemistry 2019Quote: ... Sections were then treated 2 times with 5% phosphotungstic acid for 5 minutes each (Sigma Aldrich, P4006), washed 3 times with 100% alcohol ...
-
bioRxiv - Cancer Biology 2019Quote: ... one cells have adhered remove culture medium and replace with diluted lentiviral media (500µl lentiviral media, 1.5ml DMEM, 10% FCS, 5% PenStrep, 5-10µg Polybrene (Sigma)) ...
-
bioRxiv - Biochemistry 2020Quote: ... 5% LPDS: DMEM containing 1x PenStrep and supplemented with 5% (v/v) LPDS (Sigma Aldrich, USA, S5394).
-
bioRxiv - Molecular Biology 2021Quote: ... 5% Glycerol) supplemented with 1 mM Phenylmethylsulfonyl fluoride (Carl Roth) and 5 mM β-Mercaptoethanol (Sigma Aldrich). The resuspended cells were disrupted by sonication with a Branson Digital Sonifier (Model 102C ...
-
bioRxiv - Cell Biology 2021Quote: ... Samples were blocked in PBS 1X containing 5% Normal Horse Serum and 5% bovine albumin (Sigma-Aldrich) for 1h ...
-
bioRxiv - Neuroscience 2023Quote: ... and 5 µL of the supernatant were either mixed to 5 µL of trehalase (Sigma T8778-1UN) diluted in trehalase buffer (described above ...
-
bioRxiv - Neuroscience 2024Quote: ... Rapamycin was diluted in 5% polyethylene glycol-400 (PEG400, Fluka) and 5% Tween®80 (Sigma-Aldrich) in phosphate-buffered saline (PBS ...
-
bioRxiv - Neuroscience 2024Quote: ... After destaining, the blots were blocked with 5% skim milk (Himedia, #M530) or 5% BSA (Sigma, #A7906) for Phospho-proteins for 1 hour ...
-
bioRxiv - Cancer Biology 2023Quote: ... The 5 µl samples were injected onto a ZIC-pHILIC column (150 mm × 2.1 mm; i.d. 5 µm) with a guard column (20 mm × 2.1 mm; i.d. 5 µm) (Millipore) for LC separation ...
-
bioRxiv - Bioengineering 2023Quote: ... 5×104 human MDMs or murine (NSG) BMDMs were co-cultured with 5×104 PKH26-labeled (Sigma) tumor cells in the presence of the different recombinant SiRPα decoys at 10ug/ml in serum-free medium in 96-well ultra-low adherent plates (Corning ...
-
bioRxiv - Bioengineering 2023Quote: ... 5×104 human MDMs or murine (NSG) BMDMs were co-cultured with 5×104 PKH26-labeled (Sigma) tumor cells in serum-free medium in 96-well ultra-low adherent plates (Corning ...
-
bioRxiv - Developmental Biology 2023Quote: ... Signals (ΔCt) were normalized to GAPDH expression (GAPDHfw70 5’-CCACCCATGGCAAATCC-3’ and GAPDHrev70 5’-GATGGGATTTGCATTGATGACA-3’; Sigma). The amplification efficiencies were determined by serial dilution and calculated as E = 10-1/m × 100 ...
-
bioRxiv - Neuroscience 2023Quote: ... Membranes were blocked using 5% non-fat dry milk or 5% bovine serum albumin (BSA) (Sigma-Aldrich) in Tris-buffered saline (TBS ...
-
bioRxiv - Cell Biology 2023Quote: ... in PBS) was combined with 5 µL of 5% N,N,N’,N’-tetramethylethylenediamine (TEMED) (Sigma, T9281) and 5 µL of 5% ammonium persulfate (APS ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... CNO (5 mg/kg) was dissolved daily for IP injection in 5% dimethyl sulfoxide (DMSO; Sigma Aldrich) in 0.9% saline ...
-
bioRxiv - Molecular Biology 2021Quote: ... blotted membranes were blocked with 5% milk in TBST for 30 minutes and probed overnight (4°C) with primary antibody (anti-β-actin [Sigma-Aldrich, A5441], anti-HA [Biolegend, 901501]). After 3 washes with TBST ...
-
bioRxiv - Biochemistry 2023Quote: ... the wells were washed with TBS-T and incubated with 4G10 Anti-Phosphotyrosine Antibody horseradish peroxidase conjugate (Millipore Sigma; 1:5000 dilution in TBS-T 5% milk) for 1 hour ...
-
bioRxiv - Synthetic Biology 2019Quote: ... the 6x-His Tag Polyclonal Antibody or HA Tag Polyclonal Antibody was the primary antibody and the anti-rabbit IgG-gold (10 nm) antibody (Sigma-Aldrich) was the secondary ...
-
bioRxiv - Neuroscience 2021Quote: ... This antibody is included in Validated Antibody Database (https://www.labome.com/knockout-validated-antibodies/Cx43-antibody-knockout-validation-Sigma-Aldrich-C6219.html).
-
bioRxiv - Evolutionary Biology 2019Quote: ... Plants were analyzed for production of proteins from transgenes via western blot hybridizations (explained above) with anti-FLAG M2 monoclonal primary antibody (Sigma-Aldrich, order number: F3165, diluted 1:1000) and anti-mouse-HRP secondary antibody (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2019Quote: ... Sections were then incubated overnight at 4 ° C using antibodies specific for the N-terminal amino acids 66 – 81 of the amyloid precursor protein (APP) (Millipore, Burlington MA, clone 22C11 at 1:80K), GFAP (Leica ...
-
bioRxiv - Cell Biology 2020Quote: ... Lysates were measured for protein concentration using a Non-Interfering protein Assay kit (cat#488250, Merck Millipore, Darmstadt ...