Labshake search
Citations for Millipore Sigma :
2701 - 2750 of 4323 citations for Recombinant Human IL12B His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: Human neurons were differentiated from ReNcell VM neuronal precursor cells (EMD Millipore) as described earlier [7] ...
-
bioRxiv - Physiology 2024Quote: ... HBECs were seeded directly onto human placental collagen (HPC, Sigma-Aldrich, C8374)-coated permeable supports (Costar Transwells ...
-
bioRxiv - Cell Biology 2024Quote: Pooled human umbilical vein endothelial cells (Lonza, C2519A or Sigma, 200P-05N) were cultured at 37 °C and 5% CO2 and per manufacture recommendations ...
-
bioRxiv - Microbiology 2024Quote: ... were coated with 1/20,000 dilution of Goat anti-Human Fab (Sigma) overnight at 4°C ...
-
bioRxiv - Cell Biology 2023Quote: ... Fresh citrate-anticoagulated human blood was pre-labeled with Mepacrine (Sigma-Aldrich) for 10 min at RT and perfused over the pre-coated coverslips using a flow chamber system (50 µm x 5 mm ...
-
bioRxiv - Molecular Biology 2023Quote: ... human TLR3 (forward: FH2-TLR3; CAACAGAATCATGAGACAGAC; reverse: RH2-TLR3; CACTGTTATGTTTGTGGGTAG; Millipore Sigma), GUSB (forward ...
-
bioRxiv - Immunology 2023Quote: ... Fc receptors were blocked with 10% normal human AB serum (Sigma-Aldrich). To enrich for MSCs ...
-
bioRxiv - Immunology 2023Quote: ... Fc receptors were blocked with 10% normal human AB serum (Sigma-Aldrich). After blocking ...
-
bioRxiv - Bioengineering 2023Quote: ... Human serum albumin (HSA, A1653) was purchased from Sigma-Aldrich (The Netherlands). Unless noted otherwise ...
-
bioRxiv - Immunology 2022Quote: ... blocking of Fc receptors with human Ig (Sigma-Aldrich, St. Louis, MO); surface staining with mouse anti-human CD3-APC-H7 ...
-
bioRxiv - Immunology 2023Quote: ... Fc receptors were blocked with 10% normal human AB serum (Sigma-Aldrich). For analysis of neutrophil activation ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-human talin (mouse monoclonal, 8d4, Sigma Aldrich, T3287; WB 1:750), anti-human FAK (rabbit polyclonal ...
-
bioRxiv - Cancer Biology 2023Quote: ... were as follows: Human pLKO.1-puro-shRNAMAPK14 (Sigma SHCLNG-NM_001315; TRCN0000000511), Human pLKO.1-puro-shRNAMAPK11 (Sigma SHCLNG-NM_002751 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 12µL human insulin (final concentration 2.375-2.875µg/mL, Sigma Aldrich I9278) were added to make SXO HPLM ...
-
bioRxiv - Immunology 2023Quote: ... the patterned surface was coated with 2.5% human collagen (Sigma #C5533-5MG) diluted in water for 1 h at RT ...
-
bioRxiv - Genetics 2023Quote: ... Human ESCs were lysed with 50-100 µL of RIPA buffer (Sigma) supplemented with 1x Complete EDTA-free Protease Inhibitor cocktail (Roche) ...
-
bioRxiv - Cancer Biology 2023Quote: ... human Transforming Growth Factor-β1 (hTGF-β1, Cat# T7039, Sigma-Aldrich, USA), Fibroblast Growth Factor 1 (FGF1 ...
-
bioRxiv - Immunology 2023Quote: ... single stranded DNA (ssDNA, prepared from dsDNA) and human insulin (Sigma, I9278) by ELISA as described (Gitlin et al. ...
-
bioRxiv - Immunology 2023Quote: ... were coated overnight at 4°C with anti-human Fab (Millipore Sigma) diluted 1:500 in PBS ...
-
bioRxiv - Neuroscience 2023Quote: ... supplemented with human epidermal growth factor (hEGF) (20 ng/ml, Sigma E9644) and human fibroblast growth factor 2 (hFGF2 ...
-
bioRxiv - Cell Biology 2023Quote: ... the epididymal sperm were incubated in human tubular fluid (HTF; EMD Millipore) at 2.0 x 106 cells/ml concentration for 90 minutes at 37 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... human Epidermal Growth Factor (hEGF, Cat# 62253-63-8, Sigma-Aldrich, USA), human Transforming Growth Factor-α (hTGF-α ...
-
bioRxiv - Cancer Biology 2023Quote: ... human epidermal growth factor (EGF, 20 ng ml−1; Sigma-Aldrich, E9644), human fibroblast growth factor (FGF ...
-
bioRxiv - Immunology 2022Quote: Human neutrophils were isolated by layering whole blood over Histopaque-1119 (Sigma) followed by a discontinuous Percoll gradient (Amersham Biosciences ...
-
bioRxiv - Cell Biology 2023Quote: ... we added 1µg 13C and 15N labelled human Apolipoprotein (Apo-1) (Sigma) as a known standard to 50µg total mycelial extract to assess the variance during sample preparation and measurements ...
-
bioRxiv - Immunology 2022Quote: Human 38-plex magnetic cytokine/chemokine kits (EMD Millipore, HCYTMAG-60K-PX38) were used per manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2023Quote: ... Human LDL (hLDL) was purchased from Sigma-Aldrich (St. Louis, MO, USA). Fluorescein isothiocyanate (FITC)-conjugated anti-CD41 ...
-
bioRxiv - Cancer Biology 2024Quote: ... obtained from the human CRISPR Library (Sigma-Aldrich, St Louis, MO, USA). Transduced cells were selected with puromycin ...
-
bioRxiv - Synthetic Biology 2024Quote: ... mice were injected intraperitoneally with 8 mg of human transferrin (Sigma Aldrich) to promote bacterial growth in vivo ...
-
bioRxiv - Molecular Biology 2023Quote: The human megakaryoblast leukemic cell line MEG-01 (Sigma-Aldrich, ECACC 94012401) was maintained in RPMI 1640 Medium + GlutaMAX™-I (Gibco™ – Thermo Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 g/L D-glucose with 1.25% human serum albumin (HSA) (Sigma) and either physiologic (0.1 nM ...
-
bioRxiv - Cell Biology 2023Quote: ... pre-coated with 10 μg/ml Human Plasma Fibronectin (Sigma-Aldrich, FC010). Neurons were mechanically shaken off and removed by patting the flask approximately 2 days after inoculation ...
-
bioRxiv - Cancer Biology 2024Quote: Human Huh7 cells treated with either DMSO or CHIR99021 (3 µM; Sigma) for 48h were seeded (20,000 cells per well in 100µL ...
-
bioRxiv - Neuroscience 2023Quote: ... mouse antibody specific for human SOD1 (SD-G6 1:100, Millipore Sigma), Mouse anti-human HSP70 specific for stress-inducible HSPA1A (SMC-100B 1:100 ...
-
bioRxiv - Immunology 2023Quote: ... followed by injection of 6.5 U human chorionic gonadotropin (hCG; Sigma-Aldrich) 48 h later ...
-
bioRxiv - Cancer Biology 2023Quote: ... human and bowhead fibroblasts were treated with 50 uM TDRL-505 (Sigma) (diluted 1000x into culture medium from 50mM stock solution in DMSO ...
-
bioRxiv - Immunology 2024Quote: ... and (2) the Human Cytokine 23-Plex Discovery Assay® (HD23; Millipore MILLIPLEX® Human Cytokine/Chemokine Magnetic Bead Panel II Immunology Multiplex Assay ...
-
bioRxiv - Cell Biology 2024Quote: Human retinal pigment epithelial (RPE) cells were cultured in DMEM (Sigma, #D5648) supplemented with 10% fetal bovine serum and maintained at 37°C with 5% CO2 ...
-
bioRxiv - Immunology 2024Quote: ... 5 distinct shRNAs directed against CD2AP encoding human CMS (shCMS) (Sigma-Aldrich Mission TRCN shRNA Target set ...
-
bioRxiv - Synthetic Biology 2024Quote: ... or 96-well plates pretreated with 20 µg/mL human fibronectin (Millipore) for at least 10 min at 37°C.
-
bioRxiv - Synthetic Biology 2024Quote: ... or 24-well plates pretreated with 20 µg/mL human fibronectin (Millipore) for at least 10 min at 37°C ...
-
bioRxiv - Microbiology 2024Quote: ... and then incubated with either (1) 20 µg human fibronectin (EMD Millipore); (2 ...
-
bioRxiv - Biochemistry 2024Quote: ... human full length NHE1 was cloned into p3xFLAG-CMV-14 (Sigma-Aldrich) containing a C-terminal 3xFLAG tag ...
-
bioRxiv - Cell Biology 2021Quote: ... P3 2M (AMS biotechnology #GSC-6201G 2M or #GSC-6101G 7M) and LIF ESGRO® Recombinant Mouse LIF Protein (1000 units/mL) (Millipore # ESG1107). For induction of the transgene Stemolecule Doxycycline hyclate 10 mg (Stemgent#04-0016 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The pelleted cells were lysed and used to purify the recombinant proteins with glutathione–Sepharose 4B beads (Sigma Aldrich #GE17-0756-01). The purified protein or whole cell lysate was incubated with the respective agarose beads at various time points with continuous agitation and washed before imaging ...
-
bioRxiv - Cell Biology 2022Quote: ... were used as a substrate for phospho-PKCα in a 25 µl in vitro kinase reaction using 100 ng of active recombinant PKCα enzyme (Millipore-Sigma, MA), 5 µl of a lipid activator (Millipore-Sigma ...
-
bioRxiv - Biophysics 2020Quote: Both unlabeled and 15N labeled recombinant full-length αS was expressed and purified in Rosetta™ 2(DE3) pLysS (EMD Millipore®) cells using IMPACT™ system protocol (New England Biolabs® ...
-
bioRxiv - Evolutionary Biology 2022Quote: The enzyme assay for the zebrafish Irg1-like was performed by incubating 7 µg recombinant protein with 1 mM cis-aconitate (Sigma A3412-1G) in 300 µl reaction buffer (10 mM HEPES ...
-
bioRxiv - Microbiology 2021Quote: ... were immunized intraperitoneally with 100 µl of a 1:1 emulsion containing 50 µg recombinant protein LukS or LukF and incomplete Freund’s adjuvant (Sigma-Aldrich, Taufkirchen, Germany). Mice were boosted with an emulsion of protein and incomplete Freund’s adjuvant at day 14 and 28 and bled after six weeks ...
-
bioRxiv - Cell Biology 2022Quote: Recombinant His6-EGFP used in the GFP intensity calibration (Figure 1B) was expressed in Rosetta 2 (DE3) competent cells (Millipore Sigma #71400) using pDual-EGFP plasmid (Addgene ...