Labshake search
Citations for Millipore Sigma :
2651 - 2700 of 9891 citations for SUMO2 3 Blocking Peptide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... Immunoprecipitated proteins were eluted with 0.5 mg/mL (diluted in lysis buffer) 3X FLAG peptide (Sigma, F4799) for 30 minutes on a rotator ...
-
bioRxiv - Biochemistry 2022Quote: ... bound proteins were eluted with lysis buffer containing 300 μg/ml Flag peptide (Sigma-Aldrich, Cat# F3290) at 4 °C for 45 min ...
-
bioRxiv - Cell Biology 2022Quote: ... peptides were separated using a gradient from 92% A (0.1% formic acid, FA, Sigma, in deionized water) and 8% B (0.1% FA in acetonitrile ...
-
bioRxiv - Microbiology 2022Quote: ... anti- FLAG M2 magnetic beads were incubated with 100 µg/ml 3x FLAG peptide (Sigma, #F4799- 25MG) in FIB buffer + 10% glycerol for 30 minutes at room temperature ...
-
bioRxiv - Molecular Biology 2022Quote: ... The ORF1p-FLAG protein complex bound was eluted using 200 μg/mL of 3xFLAG peptide (Sigma-Aldrich) in the Lysis150 buffer containing 0.2 mM PMSF and 1x cOmplete EDTA-free protease inhibitor cocktail by incubation at 4°C for 1 hour with gentle rotation ...
-
bioRxiv - Molecular Biology 2022Quote: ... Peptides from both consecutive digestions were combined and recovered by solid phase extraction using C18 ZipTips (Millipore), eluted in 15 μl 50% acetonitrile 0.1% formic acid ...
-
bioRxiv - Cell Biology 2024Quote: ... followed by 4 h in presence of SIINFEKL peptide + 10 µg/ml of brefeldin A (Sigma-Aldrich). Specific CD8+ T cells were evaluated by incubation with SIINFEKL257-264-APC-Labeled or SIINFEKL257-264-BV421-Labeled tetramers (NIH Tetramer Core Facility at Emory University) ...
-
bioRxiv - Molecular Biology 2023Quote: ... the proteins were eluted twice (15 min. at RT) by incubation with 3x-FLAG peptide (Sigma #F4799) at a concentration of 100 mg/mL in PBS buffer ...
-
bioRxiv - Microbiology 2024Quote: ... was utilized to measure the binding kinetics of three peptides to lipid A (L5399, Sigma, Shanghai, China). Peptides were diluted with 75 mM NaCl solution at concentrations of 100 ...
-
bioRxiv - Microbiology 2024Quote: ... Bound material was eluted by incubating the beads with HA peptide (Sigma Aldrich, St. Louis, MO, USA) for 30 minutes at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... Peptides from both consecutive digestions were recovered by solid phase extraction using C18 ZipTips (Millipore, Cat# ZTC18S096), and resuspended in 0.1% formic acid for analysis by liquid chromatography-mass spectrometry (LC-MS/MS) ...
-
bioRxiv - Cell Biology 2023Quote: ... Following primary antibodies were used for IHC and IF: mouse anti-2A peptide (Millipore, MABS2005, 1:200), rabbit anti-Active YAP1 (Abcam ...
-
bioRxiv - Cancer Biology 2023Quote: ... Recombinant protein was then eluted in lysis buffer containing 500 μg/mL 3x-FLAG peptide (Sigma-Aldrich) for 1 hr with rotation at 4°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... and each peptide fraction was then cleaned up using 2 ug capacity C18 ZipTips (Millipore, Billerica, MA) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: Peptides collected for the DIA spectral library were desalted with ZipTips C18 column (EMD Millipore, Burlington, VT), dried in speedvac and resuspended in 300µl of 0,1% TFA ...
-
bioRxiv - Molecular Biology 2023Quote: ... Complexes were eluted with 5 CVs of wash buffer supplemented with 150 µg/mL 3xFLAG peptide (Sigma). Eluted protein was analysed by SDS-PAGE ...
-
bioRxiv - Cancer Biology 2023Quote: ... To generate CD8+ T lymphoblasts responsive to ovalbumin peptide (OVAp; SIINFEKL OVA257–264, Cat# S7951, Sigma-Aldrich), T cells were incubated for 48h with OVAp (10 ng/ml ...
-
bioRxiv - Immunology 2024Quote: ... or 790 peptide (Ac-IQAQ ARGQ LMRI EFKK)15 emulsified in complete Freund’s adjuvant (CFA, Sigma-Aldrich) supplemented to 5 mg/ml heat-killed Mycobacterium tuberculosis strain H37Ra (BD Biosciences) ...
-
bioRxiv - Biochemistry 2024Quote: ... Bound protein was eluted off agarose gel with 30-50 μL 1X 3XFLAG peptide (Sigma catalog #F4799) at 4 °C with rotation for 1 h ...
-
bioRxiv - Biochemistry 2024Quote: ... INO80 was eluted by 1 ml of the same buffer with 0.5 mg/ml 3xFLAG peptide (Sigma), followed by 2X 1ml of buffer with 0.25 mg/ml 3xFLAG peptide ...
-
bioRxiv - Neuroscience 2024Quote: ... Purified PAK6 was then eluted with in Buffer B supplemented with 150 µg/ml 3xFlag peptides (Sigma).
-
bioRxiv - Cell Biology 2019Quote: ... and murine interleukin 3 (IL3)-producing WEHI-3 cells were cultured in Dulbecco’s modified Eagle medium (DMEM, Sigma-Aldrich) supplemented with 10% FBS ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2-Methoxy-3-methyl-1,4-BQ was synthesized as follows: 2 mmol 2-Methoxy-3-methyl-1,4-hydroquinone (Sigma Aldrich) and 2 mmol NaIO4 were mixed in a 50 ml round-bottom flask and 10 ml CH2Cl2 and 5 ml of water were then added ...
-
bioRxiv - Bioengineering 2022Quote: ... and then crosslinked with carbodiimide chemistry in PBS solution:1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC, Sigma-Aldrich) and N-hydroxysuccinimide (NHS ...
-
bioRxiv - Cancer Biology 2019Quote: ... Complementary oligonucleotides 5’-CACCG AGCTT GGCCC GCTTG CGGCG-3’ and 5’-AAACC GCCGC AAGCG GGCCA AGCTC-3’ (Sigma-Genosys) were annealed and ligated into the BbsI-digested restriction endonuclease site of pSpCas9(BB)-2A-Puro plasmid (gift from Dr ...
-
bioRxiv - Plant Biology 2019Quote: ... Labeled standards for indole-3-acetic acid and N-(3-indolylacetyl)-DL-aspartic acid were obtained from Sigma-Aldrich. Calibration curves were linear (r values = >0.99 ...
-
bioRxiv - Cell Biology 2020Quote: ... 3-Isobutyl-1-methylxanthine (15879) and 8-Bromoadenosine 3’,5’-cyclic monophosphate sodium salt (B7880) were purchased from Sigma. Phosphodiesterase inhibitor Tocriset containing Milrinone ...
-
bioRxiv - Neuroscience 2020Quote: ... The sections were further washed with TBS and treated with DAB solution for 20 minutes (0.025% 3, 3’-diaminobenzidine tetrahydrochloride; Sigma + 2.5% Nickel Sulphate Hexahydrate ...
-
bioRxiv - Cell Biology 2020Quote: ... The samples were resolved on the Discovery HS F5-3 column (2.1 mmI.D. x 150 mmL, 3 μm particle, Sigma-Aldrich), using a step gradient with mobile phase A (0.1% formate ...
-
bioRxiv - Cell Biology 2020Quote: ... AKAP220 siRNA (5’-CCAAUGUAAGCA GUAGUCCUCUAA A-3’) and scramble siRNA (5’-UUUAGAGGACUACUGCUUACA UUGG-3’) were from Millipore (Burlington, MA).
-
bioRxiv - Biophysics 2022Quote: 1,2-dioleoyl-sn-glycero-3-phosphocoline (DOPC) (TebuBio) and 1,2-dioleoyl-sn-glycero-3-phospho(1’-rac-glycerol) (sodium salt) (DOPG) (Sigma) were dissolved in chloroform ...
-
bioRxiv - Neuroscience 2022Quote: ... A total of 3×106 co-transformants was initially screened for growth on synthetic defined media (SD)-Leu-/ Trp-/ Ura-/ His- media containing 20mM of 3-amino-1,2,4-triazole (3-AT, Sigma-Aldrich). Plasmids were isolated from the potential positive colonies ...
-
bioRxiv - Cell Biology 2022Quote: ... the sections were immersed in a solution of 0.05% 3-3’diaminobenzidine-4HCl (DAB, Sigma-Aldrich, St Louis, MO) and 0.05% hydrogen peroxide ...
-
bioRxiv - Immunology 2020Quote: The following reagents were used in this study: 3-methyladenine (3-MA; M9281; Sigma-Aldrich, St. Louis, MO, USA), dimethylsulfoxide (D2650 ...
-
bioRxiv - Biochemistry 2020Quote: ... Sequences for the HIF1α shRNA (shRNA10819 5’-CCGGTGCTCTTTGTGGTTGGATCTACTCGAGTAGATCCAACCACAAAGAGCATTTTT-3’ and shRNA3809 5’-CCGGCCAGTTATGATTGTGAAGTTACTCGAGTAACTTCACAATCATAACTGGTTTTT-3’) were obtained from Sigma Aldrich. Scrambled shRNA was used as negative controls ...
-
bioRxiv - Molecular Biology 2022Quote: ... fungal hyphae grown (for 2-3 weeks) in liquid M-C medium without Fe were exposed 3 days to 0.5 mM ferrozine (Sigma). This was done by replacing the liquid medium by 20 ml of a freshly prepared liquid M-C medium without Fe and supplemented with 0.5 mM ferrozine ...
-
bioRxiv - Microbiology 2019Quote: ... With primers comprising the respective restrictions sites (underlined) (F: 5’-3’ TGCAGACATATGAACCCCAACCACTCTG. R: 5’-3’ TACTAGAATTCCTAGACGCTCGATGTCGCC, Sigma-Aldrich, Germany), the full ORF was amplified from pCC2FOS-Mm3 by a standard PCR reaction using the Phusion DNA polymerase (New England BioLabs ...
-
bioRxiv - Developmental Biology 2020Quote: ... paws were incubated twice for 5min with methanol 50% BABB (1/3 benzylalcohol and 2/3 benzylbenzoate, from Sigma), and then three times in pure BABB for 5min each (or until the sample is cleared) ...
-
bioRxiv - Cancer Biology 2019Quote: CT26 cells that had been stably transduced with PCK1-targetting shRNA hairpins or control hairpins were grown in vitro for 3 days and counted on day 3 using the Sceptor 2.0 automated Cell counter (Millipore).
-
bioRxiv - Microbiology 2021Quote: ... harvested at day 3 and clarified by centrifugation at 350 x g for 15 minutes (Sigma 3-16K centrifuge). Viral stocks were concentrated by centrifugation at 11 ...
-
bioRxiv - Molecular Biology 2019Quote: ... or chemically crosslinked (small RNA blots) by incubation with 0.16 M l-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC, Sigma) in 0.13 M 1-methylimidazole (Sigma) ...
-
bioRxiv - Neuroscience 2020Quote: ... Sigma)10,42 and the metabotropic glutamate receptor antagonist DL-2-Amino-3-phosphonopropionic acid (AP-3) ([1mg/kg] in PBS, stock made in 1M NaOH diluted, pH 7.4; Sigma)10,43 ...
-
bioRxiv - Biophysics 2022Quote: Peak fractions of the PEAK3/14-3-3 complex were pooled and concentrated using an Amicon Ultra-0.5 30k MWCO centrifugal filter (Millipore). Immediately before preparing cryo-EM grids ...
-
bioRxiv - Cell Biology 2022Quote: ... The samples were separated on a Discovery HS F5-3 column (2.1 mm i.d. × 150 mm long, 3 µm particle size, Sigma–Aldrich) at a flow rate of 0.25 ml min−1 with a step gradient of mobile phase A (0.1% formic acid ...
-
bioRxiv - Microbiology 2022Quote: ... HFFs were infected with 5 ×⍰104 parasites per well and treated with 3 µM 3-MB-PP1 (MilliPore Sigma) or equivalent dilution of DMSO for 20 min prior to analysis.
-
bioRxiv - Neuroscience 2024Quote: ... the sections were immersed in a solution of 0.05% 3-3’diaminobenzidine-4HCl (DAB, Sigma-Aldrich, St Louis, MO) and 0.05% hydrogen peroxide ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were separated on a Discovery HS F5-3 column (2.1 mm i.d. × 150 mm, particle size 3 μm, Sigma-Aldrich) using mobile phase A (0.1% formic acid/water ...
-
bioRxiv - Immunology 2023Quote: ... 2 and 3 were detected with another multiplex assay (MILLIPLEX MAP TGFß Magnetic Bead 3 Plex Kit; Merck Millipore).
-
bioRxiv - Neuroscience 2022Quote: ... 1 x 90 min) in 3% PBT (3% Triton-X-100 [CAS: 9002-93-1, Sigma Aldrich] in PBS) on ice ...
-
bioRxiv - Microbiology 2023Quote: ... was subjected to centrifugation through a 3 kDa cut-off membrane filter (Amicon Ultra-0.5 3-kDa Ultracell, Millipore) at 4 °C ...