Labshake search
Citations for Millipore Sigma :
2601 - 2650 of 10000+ citations for 6 METHOXY PYRIDINE 3 SULFONYL CHLORIDE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: P14 mice were euthanized and perfused transcardially with ice-cold 0.1M sodium cacodylate buffer (0.1M sodium cacodylate trihydrate [Electron Microscopy Sciences, 12310], 5 mM calcium chloride dihydrate [Sigma, 223506], pH adjusted to 7.3-7.4), followed by ice-cold EM fixative (1.25% glutaraldehyde [Electron Microscopy Sciences ...
-
bioRxiv - Molecular Biology 2021Quote: ... SC-His+3AT is minimal medium of SC-His supplemented with 3-aminotriazole (3-AT, 0.5mM, Sigma-Aldrich).
-
bioRxiv - Plant Biology 2019Quote: ... The transformants were then spotted on SD (-Trp -Leu -His) selection media containing 0.5/1mM 3-Amino-1,2,4-triazole (3-AT; Sigma, A8056). The positive interactors were then scored based on the stringency of the selection.
-
bioRxiv - Cell Biology 2021Quote: ... and mouse VPS35 (5’-GAUUCGAGAAGAUCUCCCA[dT][dT]-3’&5’-GUAAUGUUCUGGAUUAUAA[dT][dT]-3’) were purchased from Sigma-Aldrich. At 24 h after transfection ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3-Amino-1,2,4-triazole (3-AT) (≥95% TLC) were purchased from Sigma-Aldrich (St. Louis, MO, USA). Z-VAD-FMK ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 3 mg RBD protein in 3 mL PBS were mixed with equal-volume Freund’s complete adjuvant (Sigma-Aldrich) for priming ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Bixafen, (N-(3’,4’-dichloro-5-fluorobiphenyl-2-yl)-3-(difluoromethyl)-1-methylpyrazole-4-carboxamide) (Bixafen, (Sigma-Aldrich, St ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 2 mM of 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide HCl (EDC, 22980-Sigma-Aldrich, St. Louis, MO, USA) and 5 mM of N-hydroxysulfosuccinimide sodium salt (NHS ...
-
bioRxiv - Plant Biology 2023Quote: ... SD-WLH plates were supplemented with either 2.5 or 5 mM 3-amino-1,2,4-triazole (3-AT, Sigma-Aldrich).
-
bioRxiv - Molecular Biology 2022Quote: ... SM and trunSM (tissue lysates) and 14-3-3 was performed using Immobilon Western chemiluminescent HRP substrate (Millipore) and an ImageQuant LAS 500 imager (Cytiva Life Sciences) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and HRP-conjugated Anti-Rabbit IgG Secondary Antibody) and R&D Systems/Minneapolis/MN (14-3-3-Sigma polyclonal goat IgG and HRP-conjugated Anti-Goat IgG Secondary Antibody) ...
-
bioRxiv - Plant Biology 2024Quote: ... Bromo-4-Chloro-3-Indolyl a-D-galactopyranoside (X-a-gal) and 10 mM 3-amino-1,2,4-triazole (3AT) (Sigma). The plates were imaged after 60-72 incubation at 28°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... were washed three times with 3 ml of water using Amicon Ultra-4 (3 kDa cut-off, Millipore) (centrifugation at 4°C ...
-
bioRxiv - Microbiology 2023Quote: Diflufenican (N-(2,4-difluorophenyl)-2-[3-(trifluoromethyl)phenoxy]-3-pyridinecarbox-amide) was purchased from Sigma-Aldrich (Taufkirchen, Germany). Diflufenican metabolites AE B107137 (2-[3-(Trifluoromethyl)phenoxy]nicotinic acid ...
-
bioRxiv - Neuroscience 2023Quote: ... The staining was revealed by exposure to 0.025% 3-3’-diaminobenzidine tetrahydrochloride (DAB, Sigma-Aldrich, St. Louis, MO), 0.01M Imidazole (Fisher Scientific ...
-
bioRxiv - Bioengineering 2023Quote: 3 dpf larvae were anesthetized in E3 medium containing 0.16 mg/mL Tricaine (ethyl 3-aminobenzoate; Sigma-Aldrich) and caudal fin transection was performed11 30 minutes prior to imaging ...
-
bioRxiv - Zoology 2023Quote: ... The concentrations used were 15.62 x 10-3 mg and 31.25 x 10-3 mg of capsaicin (CAS 4004-86-4 Sigma) per gram of body mass ...
-
bioRxiv - Molecular Biology 2023Quote: Total RNA was isolated from testis tissues (3 WT versus 3 Clpp-null)) with TRI reagent (Sigma-Aldrich), and reverse transcription was done with SuperScript IV VILO Master Mix (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2024Quote: ... and filtered through a 3-kDa molecular filter (Amicon® Ultra Centrifugal Filter, 3 kDa MWCO, Millipore Sigma) at 4°C for 90 minutes to remove proteins ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’ – CACCGCCGCCTCCGCGCTTCCCCGA – 3’ PIEZO1_sgRNAact_TSS143 (guide 3): 5’ – CACCGAGGCCCCAACGCACCAGGGC – 3’ Modified U251 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM; D5796, Sigma), supplemented with 10% foetal bovine serum (FBS ...
-
bioRxiv - Biophysics 2021Quote: ... and (3-Aminopropyl) triethoxysilane (Sigma-Aldrich, A3648) in a v:v:v ratio of 100:5:3 ...
-
bioRxiv - Cancer Biology 2021Quote: ... were cultured on 3% polyHEMA (Sigma, P3932) coated 96 well plate for 48 h in a 37 °C humidified incubator with 5% carbon dioxide.
-
bioRxiv - Cell Biology 2019Quote: ... and 5’-UCGUGGAAAGUUUGCUGCAGGGAAA[dT][dT]-3’ (Sigma) (Doucet et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... sodium-3-methyl-2-oxobutyrate (ketovaline, Sigma), 3-methyl-2-oxovaleric acid sodium salt (ketoisoleucine ...
-
bioRxiv - Cell Biology 2020Quote: ... 500 μM Indole-3-acetic acid (Sigma) was added 8 h after released ...
-
bioRxiv - Cell Biology 2020Quote: ... 1i-LIF (3 µM CHIR99021, Sigma-Aldrich, cat.no ...
-
bioRxiv - Cell Biology 2020Quote: ... 1:100 Phosphatase Inhibitor cocktail 3 (Sigma), 50mM EDTA ...
-
bioRxiv - Cell Biology 2020Quote: ... – 50 μM in DMSO (3) Tunicamycin (Sigma) – 5 μg/ml in DMSO for 6hr (4 ...
-
bioRxiv - Immunology 2021Quote: ... or 3-MA (5 mM, Sigma-Aldrich), as indicated in the figure legends ...
-
bioRxiv - Genetics 2021Quote: ... Ni-NTA resin (EMD Millipore, 70691-3) was used to remove unreacted His-tagged nanobodies and His-tagged Sortase 5M enzyme ...
-
bioRxiv - Biochemistry 2020Quote: ... or 3) Lipopolysaccharide (LPS) (Sigma-Aldrich L3024) + interferon-γ (IFNγ ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 3 mM deferoxamine from Sigma (# BP987). Next ...
-
bioRxiv - Developmental Biology 2021Quote: ... 3-Indoleacetic acid (Auxin, Sigma-Aldrich, I2886) was dissolved in 100% ethanol and diluted 400 times in the culture medium obtaining concentrations as indicated ...
-
bioRxiv - Developmental Biology 2020Quote: ... 3% Bovine Serum Albumin (BSA; Sigma, A2153), 0.5% Triton™X-100 (Sigma ...
-
bioRxiv - Developmental Biology 2020Quote: ... 3 % normal donkey serum (Sigma-Aldrich D9663), and 0.3 % Triton X-100 (Sigma 93443) ...
-
bioRxiv - Developmental Biology 2020Quote: ... phosphatase inhibitor cocktail 2 and 3 (Sigma), and cOmplete EDTA-free protease inhibitor cocktail (Roche) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1% Phosphatase Inhibitor Cocktail 3 (Sigma-Aldrich) and 0.5% Phosphatase Inhibitor Cocktail 2 (Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2021Quote: ... and the following primers (Sigma, 5′-3′): 18S F ...
-
bioRxiv - Molecular Biology 2020Quote: ... with 3 μg anti-FLAG (M2, Sigma), anti-PAN acetylated H3 (Merck) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2-3 mL mineral oil (M8410, Sigma) was used to fully overlay the droplets to prevent the evaporation.
-
bioRxiv - Bioengineering 2022Quote: ... in PBS solution containing 3% BSA (Sigma) for 15 min ...
-
bioRxiv - Immunology 2021Quote: ... and 3% foetal calf serum (FCS; Sigma). To distinguish between live and dead cells ...
-
bioRxiv - Molecular Biology 2021Quote: ... Samples were blocked with 3% BSA (Sigma) in PBS before overnight incubation at 4°C with antibodies anti-γH2AX (1:250 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and either 3 mM unlabeled ATP (Sigma) or 25 μCi of [γ32P] ATP ...
-
bioRxiv - Biophysics 2020Quote: ... 100 μg/mL 3×FLAG peptide (Sigma)) ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... agonist (3 μM quisqualate, Sigma-Aldrich Q2128) and photoswitches (1 μM from 1 mM stocks in DMSO ...
-
bioRxiv - Microbiology 2019Quote: ... 3-methylphenol (m-cresol; 99% Sigma-Aldrich), 4-methylphenol (99% Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2019Quote: ... Tribbles 3 antibody was purchased from Sigma. Primers for cloning and RT qPCR were supplied by Integrated DNA Technologies (IDT) ...
-
bioRxiv - Biochemistry 2020Quote: ... 3 µM Na- orthovanadate (Sigma; Cat. # S6508), 1.2 mM DTT (Sigma ...
-
bioRxiv - Cell Biology 2019Quote: ... and 1x phosphatase inhibitors cocktail 3 (Sigma)) before freezing disruption in liquid nitrogen ...