Labshake search
Citations for Millipore Sigma :
2601 - 2650 of 10000+ citations for 5 Benzyloxy pyrimidine 2 carbonitrile since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... 5 μM diphenyleneiodonium chloride (DPI) (Millipore-Sigma ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4-OHT (5 µM; Sigma-Aldrich), Dp44mT (5 μM) ...
-
bioRxiv - Genomics 2023Quote: ... 5 units of lysostaphin (Sigma Aldrich), 5 units of mutanolysin (Sigma Aldrich) ...
-
bioRxiv - Genomics 2023Quote: ... 5 units of mutanolysin (Sigma Aldrich), and 100 ul of 0.1mM glass beads (Biospec) ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.1% DMSO (Sigma, D2650-5×5ML), or 0.1% water were used in the 1.5% agarose pads and to make the inhibitor or control solutions ...
-
bioRxiv - Systems Biology 2023Quote: ... 5 µg/ml insulin (Sigma, I1882), 1 µg/ml hydrocortisone (Sigma ...
-
bioRxiv - Cell Biology 2023Quote: ... 5% bovine serum albumin (BSA, Millipore), or 5% non-fat milk powder mixed with 3% BSA for 1h at room temperature ...
-
bioRxiv - Biochemistry 2023Quote: ... and gentamycin 5 mg/mL (Sigma) at 37 °C in 7.4% CO2.
-
bioRxiv - Cancer Biology 2023Quote: ... 5 uM latrunculin B (Sigma, #428020) was added into the actin with G-buffer ...
-
bioRxiv - Biochemistry 2023Quote: ... and 5 mM pyruvate (Sigma S8636) were added to the reaction buffer ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 5 μg/ml bovine insulin (Sigma–Aldrich ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 μg/mL insulin (Sigma, I9278), 1 mM L-Glutamine (Life Technologies ...
-
bioRxiv - Cell Biology 2023Quote: ... 5% goat serum (Sigma Aldrich, G9023) for staining with antibodies against Chromogranin A (1:200 ...
-
bioRxiv - Cancer Biology 2023Quote: ... insulin (5 μg/ml, Sigma Aldrich) and 5 ng/ml murine Epidermal Growth Factor (mEGF ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 5 μg/mL Insulin (Sigma), at 37℃ with 5% CO2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... FCCP (370-86-5, Sigma Aldrich, uncoupling agent measuring the maximal respiration capacity) ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 mM malate (Sigma-Aldrich, M7397), and 1 μM Oregon Green 488 Bapta-6F (Invitrogen ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 mM 2,6-dichloroindophenol (Sigma-Aldrich), and 7.5 mM coenzyme Q1 were added ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5% donkey serum (D9663, Millipore Sigma) and 0.02% Triton X-100 ...
-
bioRxiv - Cell Biology 2024Quote: ... and 5 mM NaCl (S9888, Sigma), or 2 ...
-
bioRxiv - Cell Biology 2024Quote: ... and 5 µM STLC (Sigma-Aldrich) for 30 min ...
-
bioRxiv - Cancer Biology 2024Quote: ... with 5% FBS (Sigma, Cat. #F0926) at 37°C and 5% CO2 ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 μg/ml insulin (Sigma-Aldrich), and 10 mM HEPES (Corning ...
-
bioRxiv - Microbiology 2024Quote: ... nitrogen (NH4Cl, 5 mM, Sigma Aldrich), sulfur (Na2SO4 ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 μg/ml insulin (Sigma-Aldrich) and 5 ng/ml murine Epidermal Growth Factor (mEGF ...
-
bioRxiv - Physiology 2024Quote: ... NEFA (Sigma Aldrich MAK044, 5 μL). All assays were performed in duplicate and compared to the provided standard curve ...
-
bioRxiv - Microbiology 2024Quote: ... DMSO (Sigma Aldrich, 67-68-5), EDTA ...
-
bioRxiv - Immunology 2024Quote: ... 5% Triton X-100 (T8787; Sigma) (v/v ...
-
bioRxiv - Biophysics 2024Quote: ... 5 % glycerol (Sigma-Aldrich cat G7757), 5 mM β-mercaptoethanol (BME ...
-
bioRxiv - Biophysics 2024Quote: ... 5-methylphenazinium methyl sulphate (PMS, Sigma) was dissolved in water and used at a final concentration of 15 µM.
-
bioRxiv - Immunology 2024Quote: ... 5-BDBD (Sigma-Aldrich, 10 μM), Sodium Lactate (1 mM ...
-
bioRxiv - Biophysics 2024Quote: ... 5 µg/ml prolactin (Sigma-Aldrich L6520 ...
-
bioRxiv - Physiology 2024Quote: ... 5 mM dithiothreitol (DTT; Sigma-Aldrich) was added to sample and incubated at 37 °C for 1 hour (Eppendorf ThermoMixer F1.5 ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 mM ethyl pyruvate (Sigma #E47808), and 0.4 mM sodium ascorbate (Sigma #11140) ...
-
bioRxiv - Neuroscience 2024Quote: ... and 5 µM NMDA (Sigma #M3262). The spinal cords were allowed to recover for 30 minutes at room temperature before recording ...
-
bioRxiv - Microbiology 2024Quote: ... 5 µg/ml Nile red (Sigma) for 5 min in the dark ...
-
bioRxiv - Microbiology 2024Quote: ... 5 µg/mL hemin (Millipore sigma), 2.85 mM L-cysteine (Acros Organics) ...
-
bioRxiv - Microbiology 2024Quote: ... 5 μL DMSO (Sigma, #D9170-5VL), and P5 forward and P7 reverse primers each at a final concentration of 1 μM ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 KU Benzonase (Sigma-Aldrich, E8263), and 1× cOmplete ULTRA Protease Inhibitor Tablets (one tablet per 10mL of lysis buffer ...
-
bioRxiv - Microbiology 2024Quote: ... 5 μg/mL cefsulodin (Sigma Aldrich), 50 μg/mL cycloheximide (GoldBio) ...
-
bioRxiv - Microbiology 2024Quote: ... 5 μg/mL trimethoprim (Sigma Aldrich), and 10 μg/mL vancomycin were added ...
-
bioRxiv - Microbiology 2024Quote: ... ML141 (71203-35-5, EMD millipore), EHop-016 (S7319 ...
-
bioRxiv - Microbiology 2024Quote: ... in 5% phosphoric acid (Sigma-Aldrich)) ...
-
bioRxiv - Cancer Biology 2024Quote: ... calcium chloride (5 mM, Sigma-Aldrich), DNase I (125 U/mL ...
-
bioRxiv - Microbiology 2024Quote: ... with 5% β-Mercaptoethanol (Sigma-Aldrich). Western blots were run on Mini-PROTEAN precast gels and then transferred to a Trans-Blot 0.2 µm nitrocellulose membrane using the Trans-Blot Turbo Transfer System (Bio-Rad) ...
-
bioRxiv - Microbiology 2024Quote: ... Rev: 5’ TGTCCGTGAGCCTTCCTGTTTCCCACAGCGTCC 3’ (Sigma-Aldrich). RNA was generated from linearized DNA by in vitro transcription and transfected into BHK21 cells using Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Developmental Biology 2024Quote: ... 0.1% Triton (9036-19-5, Sigma) in PBS for 1 hour at room temperature ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 mM pyruvate (Sigma, catalog #P2256), 10 mM glutamate (Sigma ...
-
bioRxiv - Synthetic Biology 2024Quote: ... lysozyme (5 mg/ml; Sigma-Aldrich), and RNase A (200 μg/ml ...
-
bioRxiv - Immunology 2024Quote: ... brefeldin A (5 ug/ml, Sigma), and anti-CD107a (Biolegend) ...