Labshake search
Citations for Millipore Sigma :
2551 - 2600 of 10000+ citations for 6 4 Methyl 1 piperazinyl N 5 methyl 1H pyrazol 3 yl 2 1Z 2 phenylethenyl 4 pyrimidinamine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... was revealed with 5-bromo-4-chloro-3-indolyl β-D galactoside (X-gal) (Sigma-Aldrich, Carlsbad, CA, USA). Diploid cells were grown on SC medium supplemented with 20 mg/L adenine hemisulfate ...
-
bioRxiv - Microbiology 2024Quote: ... Coloring reactions were performed with nitro blue tetrazolium/5-Bromo-4-chloro-3-indolyl phosphate (NBT/BCIP) solution (Sigma), and then sections were washed in PBS ...
-
bioRxiv - Immunology 2020Quote: ... for 4 hrs and 5 mM ATP (Sigma, A26209) for different periods up to 4 hours.
-
bioRxiv - Genomics 2022Quote: ... 4 mL of 5 mM IBMX (Sigma, #I-5879), 1 ng/mL Heparin (Sigma ...
-
bioRxiv - Immunology 2023Quote: ... rabbit anti-aquaporin 4 (Sigma Millipore, 5 μg/ml), rabbit anti-aquaporin 5 (Sigma Millipore ...
-
bioRxiv - Immunology 2023Quote: ... rabbit anti-aquaporin 4 (Sigma Millipore, 5 μg/ml), rabbit anti-aquaporin 5 (Sigma Millipore ...
-
bioRxiv - Biophysics 2020Quote: ... The cells were collected by centrifugation (6000 g, 5 min, 4 °C, Sigma 4-16KS tabletop centrifuge), lysed in lysis buffer (5 mM Tris ...
-
bioRxiv - Cell Biology 2020Quote: ... the membrane was washed once with TBST and incubated with primary antibodies at 4°C for 12 hrs (Phospho-ERK1/2 1:500 (Sigma Aldrich, #E7028); ERK1/2 1:1000 (Cell Signaling ...
-
bioRxiv - Neuroscience 2021Quote: ... A CRISPR-Cas9 crRNA (5’- GAGGCCAAGATGAGTACTGAGG-3’) targeting exon 2 of Blvra was synthesized by Sigma Aldrich. A single-stranded oligo homology template (5’-ATGGACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGATTACAAGGATGACG ATGACAAGATGAGCACGGAGGTGAGCTGCCCTCAGGGGCTGTAAGGGACACCTTTGCTG-3’ ...
-
bioRxiv - Cancer Biology 2021Quote: Polyacrylamide (PA) gels of varying stiffness (0.5, 2, and 5 kPa) were fabricated on 3-APTMS (Sigma) functionalized glass coverslips by combining 40% acrylamide and 2% bis-acrylamide in specific ratios as described previously [81] ...
-
bioRxiv - Neuroscience 2023Quote: ... 3-dione (CNQX) and 50 mM D,L-2-amino-5-phosphonovaleric acid (APV) acquired from Sigma to suppress post-synaptic responses ...
-
bioRxiv - Genomics 2022Quote: ... 5(6)- carboxyfluorescein (5(6)-FAM) (Sigma Aldrich) (46 ...
-
bioRxiv - Cell Biology 2020Quote: ... and 5-bromo-2-deoxyuridine (BrdU, Sigma) was added to the culture media at a final concentration of 10 μM for 20 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... otherwise 2-5% DMSO (Sigma, Cat# D9170) were used instead ...
-
bioRxiv - Bioengineering 2022Quote: ... 5-norbornene-2-carboxylic acid (Sigma-Aldrich), 4-dimethylaminopyridine (DMAP ...
-
Cell culture dimensionality influences mesenchymal stem cell fate through cadherin-2 and cadherin-11bioRxiv - Cell Biology 2019Quote: ... reduced with 5% 2-mercaptoethanol (Sigma-Aldrich) and separated on 4–15% TGX gel (Bio-Rad ...
-
bioRxiv - Cell Biology 2019Quote: ... 2-amino-5-diethylaminopentane (A48806, Sigma Aldrich), daunorubicin (30450 ...
-
bioRxiv - Cancer Biology 2021Quote: BrdU (5-Bromo-2-deoxyuridine) (Millipore, 203806) was used to assess cell proliferation and the assay was performed in 96-well plates ...
-
bioRxiv - Cell Biology 2022Quote: ... 5-bromo-2’-deoxyuridine (BrdU) (Sigma, 10280879001) solution was peritoneally injected into live mouse at a concentration of 150mg/kg ...
-
bioRxiv - Biophysics 2022Quote: ... 2 or 5% (PEG-8000, Sigma Aldrich); iv ...
-
bioRxiv - Neuroscience 2021Quote: ... 5-fluoro-2-deoxyuridine (Millipore cat. # 343333) was added at a concentration of 4 µM to prevent glial cell overgrowth ...
-
bioRxiv - Immunology 2021Quote: ... 5.5×10−5 M 2-mercaptoethanol (Sigma), 10mM HEPES (Gibco) ...
-
bioRxiv - Immunology 2021Quote: ... 5-Iodo-2-deoxyuridine (IdU; Sigma, 100uM) and puromycin (Sigma ...
-
bioRxiv - Cancer Biology 2022Quote: ... Dimethyl 2-oxoglutarate (5 mM; Sigma, 349631), and 3-Mercaptopicolinic Acid (5 mM ...
-
bioRxiv - Microbiology 2022Quote: ... supplemented with 5% 2-mercaptoethanol (Sigma-Aldrich) for western blot.
-
A modular CRISPR screen identifies individual and combination pathways contributing to HIV-1 latencybioRxiv - Microbiology 2022Quote: ... containing 5% 2-Mercaptoethanol (Millipore Sigma; M3148) and boil the samples at 95°C for 5 min ...
-
bioRxiv - Neuroscience 2023Quote: ... and 5-Fluoro-2’-desoxyuridine (Sigma # F0503), was added to a final concentration of 3 µM on the third day and the medium was exchanged three times per week.
-
bioRxiv - Developmental Biology 2024Quote: ... supplemented with 5% 2-betamercaptaethanol (M3148, Sigma) was added to each sample ...
-
bioRxiv - Developmental Biology 2024Quote: For BrdU (5-Bromo-2’-deoxyuridine, Sigma) labeling ...
-
bioRxiv - Microbiology 2024Quote: ... supplemented with 5% 2-mercaptoethanol (Sigma-Aldrich) for western blotting.
-
bioRxiv - Immunology 2023Quote: 5-bromo-2’-deoxyuridine (BrdU; Sigma-Aldrich) was diluted to 5mg/ml in sterile PBS ...
-
bioRxiv - Cell Biology 2023Quote: ... 5’-Iodo-2’deoxyuridine (IdU-Sigma-Aldrich) was used for 20 hours at 100μM ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5-Chloro-2’-deoxyuridine (CldU) (Sigma; #C6891). LP and SP (Bachem ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5-Iodo-2’-deoxyuridine (IdU) (Sigma; #I7125), 5-Chloro-2’-deoxyuridine (CldU ...
-
bioRxiv - Microbiology 2023Quote: ... with 5% 2-Mercaptoethanol (Sigma-Aldrich, M3148) and denatured at 95°C for 5 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5-aza-2’-deoxycytidine (DAC, Sigma A3656) was dissolved in DMSO:PBS at a ratio of 1:150 and stored at −80°C ...
-
bioRxiv - Cell Biology 2023Quote: – 5-ethylene-2′-deoxyuridine (EdU) (Sigma-Aldrich) was dissolved in sterile DMSO at 125 mM and stored at –20°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... containing 5% 2-Mercaptoethanol (Sigma-Aldrich, M6250) and boiled at 95°C for 5 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... 5-ethynyl-2’-deoxyuridine (EdU) (Sigma-Aldrich) Was dissolved in DMSO and used at 10 μM for EdU incorporation assay or 100 μM for SIRF assay.
-
bioRxiv - Cell Biology 2023Quote: ... 2-5 (100081) was purchased from Sigma.
-
bioRxiv - Neuroscience 2024Quote: ... 5-bromo-2’-deoxyuridine (BrdU; Sigma-Aldrich) was intraperitoneally injected into the mice for the last 5 days of ZSS treatment ...
-
bioRxiv - Neuroscience 2021Quote: ... partial 5-HT2A/2CR agonist), and 8-hydroxy-2-(di-n-propylamino)tetraline (8-OH-DPAT, 5-HT1A agonist) were obtained from Sigma/Aldrich ...
-
bioRxiv - Cell Biology 2019Quote: ... 10 µM 5-aza-2′-deoxycytidine (5’-aza-dC; Sigma) was added to the medium ...
-
bioRxiv - Immunology 2024Quote: ... NK cells were pretreated with DMSO or 2-DG (0.5 mM, 1 mM, 2 mM, 5 mM; Sigma-Aldrich, USA), BAY 87 (10 μM ...
-
bioRxiv - Developmental Biology 2019Quote: ... Tissue was suspended in cold methanol with 1 mM 6-propyl-2-thiouracil (PTU; Sigma) and homogenized by sonication ...
-
bioRxiv - Biophysics 2021Quote: ... and 1 mM (±)-6-hydroxy-2,5,7,8-tetramethylchromane-2-carboxylic acid (Trolox; 238813-5G, Sigma-Aldrich). To obtain images for training the DeepSTORM model ...
-
bioRxiv - Cancer Biology 2022Quote: ... SNB19 and BTSC 233 cells were treated with 10 mM 4-methylthio-2-oxobutyric acid (MTOB, Sigma) for 24h ...
-
bioRxiv - Molecular Biology 2021Quote: ... Tubïgen larva from each treatment group were incubated in 4ug/ml Diasp (2-Di-4-Asp, Sigma) and 0.3 ug/ml DioC6 (3,3-dihexyloxacarbocyanine iodide ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were then treated with 2 mM (or 4 mM for HCoV 229E) bromouridine (BrU; Sigma Aldrich) and 15 μM actinomycin D (ActD ...
-
bioRxiv - Genetics 2020Quote: ... Intestinal organoids were induced on day 2 after splitting using 800 nM 4-OH tamoxifen (Sigma H7904) for 24 h.