Labshake search
Citations for Millipore Sigma :
2501 - 2550 of 10000+ citations for IL 3 Human His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Fixed embryos were washed with 3%HCl/70%EtOH solution for 3 times and stained in 1% Victoria blue B (Sigma) dissolved in 3%HCl/70%EtOH overnight ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and oligonucleotides recognizing both lacO (5′-CATGTGGAATTGTGAGCGGATAACAATTTGTGG-3′) and Gal4 (5′-TCGACGGAGGACAGTCCTCCG-3′) sequences labelled with Biotin were purchased (Sigma). Oligonucleotides were mixed at 100 ng/μL and resuspended in hybridization buffer (50% formamide ...
-
bioRxiv - Biochemistry 2020Quote: To examine the RNA binding mode of the N-NTD we used a commercially available 7mer RNA duplex that was prepared by annealing of RNA oligonucleotides 5’-CACUGAC-3’ and 5’-GUCAGUG-3’ (Sigma). The RNA oligonucleotides were mixed in a molar ratio 1:1 at the final concetration 200 μM of each oligonucleotide and water supplemented with 50 mM NaCl ...
-
bioRxiv - Neuroscience 2021Quote: ... HT22 cells were infected with lentivirus carrying the control scrambled-shRNA (5’-CCGGCAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCTTCATCTTGTTGTTTTTG-3’) or CB-specific shRNA (5’-CCGGGATTGGAGCTATCACCGGAAACTCGAGTTTCCGGTGATAGCTCCAATCTTTTTG-3’) with polybrene (Sigma) for two days ...
-
bioRxiv - Cell Biology 2021Quote: ... Skin was minced into small pieces (about 2-3 mm × 2-3 mm) and digested by incubation with 1 mg/mL collagenase V (Sigma) in PBS for one hour with shaking (250 rpm) ...
-
bioRxiv - Cell Biology 2021Quote: High performance liquid-chromatography-purified RNA oligonucleotides 5’-(UG)12-3’ and 5’-(UC)12-3’ were ordered from Sigma. The oligonucleotides were biotinylated using the Pierce RNA 3’ End Desthiobiotinylation kit (Cat n° 20163 ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2/3 mTeSR1 + 1/3 N2 medium + LSX + PSD Day 6,7: 1/3 mTeSR1 + 2/3 N2 medium + PSD At day 6 cells were detached by Accutase solution (Sigma-Aldrich) and incubated at 37°C for 20 minutes to obtain a single cell suspension ...
-
bioRxiv - Physiology 2022Quote: The membrane-permeable 8-Br-cGMP (8-bromoguanosine 3′,5′-cyclic monophosphate, B1381) and 8-Br-cAMP (8-bromoadenosine 3′,5′-cyclic monophosphate, B5386) were from Sigma. ANP (AS-20648) ...
-
bioRxiv - Cell Biology 2024Quote: ... The activation was achieved using 50 μL of the initial microbead’s solution following the two-step 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide (EDC)/sulfo NHS covalent coupling (Estapor carboxyl-modified dyed microspheres protocol, Merck Millipore) in MES buffer (30 min ...
-
bioRxiv - Developmental Biology 2023Quote: ... The samples were resolved on the Discovery HS F5-3 column (2.1 mm ID × 150 mm, 3-μm particle, Sigma-Aldrich), using a step gradient with mobile phase A (0.1% formate / water ...
-
bioRxiv - Cancer Biology 2024Quote: ... 10 nM siRNA against DDX3X (5’-CCUAGACCUGAACUCUUCAGAUAAU dTdT-3’) or 20 nM siRNA against GRSF1 (5’-GUGCCUCUCUGCUGCCGCAdTdT-3’) which were synthesized by Sigma. Cells were subsequently incubated at 37 °C for 48 h before harvesting and analysis ...
-
bioRxiv - Microbiology 2024Quote: ... The amine reactive second-generation (AR2G) biosensors were processed with 1-ehtyl-3-(3-dimethylaminopropy) carbodiimide hydrochloride (EDC, E1769, Sigma) and sulfo-N-hydroxysulfosuccinimide (s-NHS ...
-
bioRxiv - Bioengineering 2023Quote: ... d(AA)-3’ and antisense strand: 5’-r(UUU GCC AUG GCA GAA AUA GGC) d(TT)-3’ were purchased from Sigma–Aldrich ...
-
Competition co-immunoprecipitation reveals interactors of the chloroplast CPN60 chaperonin machinerybioRxiv - Molecular Biology 2023Quote: ... was PCR amplified from cDNA clone AV639302 (Kazusa) with oligos 5’-GCCAGGATCCGGAGAATTTATACTTCCAGGGTGCTACCCCCGTGCCCAAG-3’ and 5’-CGCGCGAAGCTTTTACGAGAGCTGGGCCAGG-3’ and cloned with BamHI and HindIII into petDUET (Novagen), giving pFW21 ...
-
bioRxiv - Bioengineering 2023Quote: Liposomal NPs encapsulating MRX-2843 or venetoclax were made by first mixing organic solutions of DSPC (1,2-distearoyl-sn-glycero-3-phosphocoline; NOF Corporation, Shanghai, China), DSPG (1,2-distearoyl-sn-glycero-3-phosphoglycerol, sodium salt; NOF) and cholesterol (Sigma-Aldrich) lipids together at a 7:2:1 mol:mol ratio ...
-
bioRxiv - Plant Biology 2023Quote: ... Designed primers included standard FAM or HEX compatible tails (FAM tail: 5’ GAAGGTGACCAAGTTCAT-GCT 3’; HEX tail: 5’ GAAGGTCGGAGTCAACGGATT 3’ (Sigma)) Table S2) ...
-
bioRxiv - Cell Biology 2023Quote: ... Dried extracts were phase-separated using -20°C LCMS-grade chloroform/methanol/water (1:3:3, v/v) (Sigma Aldrich).
-
bioRxiv - Plant Biology 2023Quote: Leaf disks (3 mm) of Arabidopsis thaliana and Nicotiana benthamiana were fixed with 3% (w/v) glutaraldehyde (Sigma, Taufkirchen, Germany) in 0.1 M sodium cacodylate buffer (SCB ...
-
bioRxiv - Cell Biology 2023Quote: ... AID Full Length F 5’-CCCAAGCTTATGGGCAGTGTCGAGCTG-3’ AID 1-114 F 5’-CCCAAGCTTATGGCAGTGTCGAGCTGAATC-3’ AID 31-114 F 5’-CCCAAGCTTAGAGGGTTCTCAGAGACGGTTG-3’ AID 71-114 F 5’-CCCAAGCTTAAAGATCCAGCCAAACCTCC-3’ AID R 5’-AAGGAAAAAAGCGGCCGCTACCTTCACGAACG-3’ PCR products were cloned into p3xFLAG-CMV10-PP6c construct (Sigma) using restriction digests and sequence confirmed ...
-
bioRxiv - Neuroscience 2023Quote: ... were placed in the middle of a 2% agar plate containing a container with 10 µl n-amylacetate (AM, diluted 1:50 in mineral oil; SAFC) or 3-Octanol (3-Oct, Sigma) on one side and a blank on the other side ...
-
bioRxiv - Microbiology 2023Quote: ... organoids were treated four days after ex vivo Hsp60 deletion with the Ido1 agonist 3-hydroxyanthranilic acid (3-HAA; 200µM; Sigma-Aldrich) or the Ido1 antagonist dimethyltryptamine (1-D-MT ...
-
bioRxiv - Cell Biology 2023Quote: ... except the protein sample was concentrated to 4 mg/ml and mixed with 0.005% 3-([3-Cholamidopropyl]dimethylammonio)-2-shydroxy-1-propanesulfonate (CHAPSO; Sigma Aldrich) immediately before vitrification ...
-
bioRxiv - Molecular Biology 2023Quote: ... were cleaned by sonication with 3 M NaOH then Piranha solution (2:3 ratio of 30% (w/w) H2O2 to sulfuric acid) and treated with 3-glycidyloxypropyl trimethoxysilane (GOPTS) (Sigma). GOPTS was then reacted with a mixture of 9 parts α-hydroxy-ω-amino PEG 3000 to 1 part α-biotinyl-ω-amino PEG 3000 by weight (Rapp Polymere) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Lysate samples were MWCO filtered using 3 kDa and 10 kDa Amicon filters (Merck Millipore, catalog no.: UFC500308 (3 kDa), UFC501008 (10 kDa) ...
-
bioRxiv - Neuroscience 2024Quote: ... The AAV titer was quantified usizg PCR (5′-TGA GTC ACC CAC ACA AAG GA-3′ and 5′-CCA AGC TGG CCT AAC TTC AG-3′) after proteinase K treatment (Merck Millipore). Under anesthesia with a mixture of medetomidine (0.3 mg/kg ...
-
bioRxiv - Cancer Biology 2024Quote: ... OVCAR-3 and SK-OV-3 cells were treated with the dicarbonyl stress-inducing compound methylglyoxal (MG) (M0252, Sigma-Aldrich) for 48-72 h.
-
bioRxiv - Plant Biology 2024Quote: ... followed by the reaction of Fe3+ with the xylenol orange dye (o-cresolsulfonephthalein 3′,3″-bis[methylimino] diacetic acid, sodium salt; Sigma). Ten seeds were placed in each well of 12-well plates containing 2 mL of liquid MS/2 medium ...
-
bioRxiv - Cell Biology 2019Quote: ... the membranes were incubated overnight at 4°C with the adequate primary antibodies in TBST buffer: mouse anti-His-tag (1:2000, Millipore, 05-949), rabbit anti-CAP-D2 serum (1:1000 ...
-
bioRxiv - Cell Biology 2021Quote: ... ICR1-His6 and ICR2-His6 were stained with an anti-His antibody (1:5,000) and secondary antibody conjugated with fluorescein (Sigma; F0257; 1:5,000). The solution was then centrifuged at 12,000 g for 5 min ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were routinely passaged in Dulbecco’s modifies Eagle medium (DMEM+) culture media with serum (DMEM, low glucose, from Sigma-Aldrich; 10% HI-FBS; 1% penicillin-streptomycin solution from Sigma-Aldrich; 1% 200mM L-glutamine from Sigma-Aldrich) ...
-
bioRxiv - Plant Biology 2021Quote: ... were inserted between the NdeI and XhoI sites of the bacterial expression vector pET-24a containing a HIS-tag (Novagen, Madison, USA). The ligated products were transformed into TOP10 E ...
-
bioRxiv - Microbiology 2021Quote: ... from ffmA was PCR amplified and cloned in frame as a NdeI/HindIII fragment upstream of the C-terminal 6x-His tag in pET29a+ (EMD Millipore, Inc.) to form plasmid pSP113 ...
-
bioRxiv - Microbiology 2020Quote: Recombinant full length SIC proteins were purified using affinity chromatography with a His-bind column as per manufacturer’s instructions (Novagen, Merck, Darmstadt, Germany). sic1.300 ...
-
bioRxiv - Microbiology 2021Quote: N-terminal His-tagged recombinant proteins were expressed in Rosetta™ 2(DE3) pLysS competent cells (71403; Novagen, Inc., Madison, WI, USA) by induction with 0.5 mM isopropyl β-d-1-thiogalactopyranoside at 30°C for 4 h (N ...
-
bioRxiv - Bioengineering 2023Quote: ... The supernatant containing the nanobody proteins was then purified by immobilized metal-ion affinity chromatography (IMAC) using HIS-Select® Cobalt Affinity Gel (Sigma H8162) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... then concentrated using 15 ml Amicon 100 kDa centrifuge filter columns and purified by nickel column affinity chromatography (Novagen His-Bind Resin) as per the manufacturer’s instructions.
-
bioRxiv - Plant Biology 2024Quote: The open reading frame of WsGT4 and WsGT6 was cloned into the NheI/HindIII and NdeI/BamHI sites of pET28a bacterial expression vector in-frame with the C-terminal 6X-His-tag (Novagen, http://www.emdbiosciences.com) resulting in pET28a::WsGT4 and pET28a::WsGT6 respectively (Figure S1 A&B) ...
-
bioRxiv - Plant Biology 2024Quote: The open reading frame of CfADH1 and CfAKR2b was cloned into the NdeI/EcoRI sites of pET28a bacterial expression vector in-frame with the C-terminal 6X-His-tag (Novagen, http://www.emdbiosciences.com) resulting in pET28a::CfADH1 and pET28a::CfAKR2b ...
-
bioRxiv - Neuroscience 2024Quote: ... The supernatant containing the nanobody proteins was then purified by immobilized metal-ion affinity chromatography (IMAC) using HIS-Select® Cobalt Affinity Gel (Sigma H8162) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... the nitrocellulose membranes containing the purified recombinant fusion proteins were incubated with mouse anti-His antibody [clone HIS.H8] (Millipore Sigma, Burlington, Massachusetts). HRP-conjugated rabbit anti-mouse IgG antibody (SouthernBiotech ...
-
bioRxiv - Plant Biology 2020Quote: ... and phosphatase inhibitor cocktail 3 (Sigma-Aldrich; P0044). After centrifugation at 13,000 rpm for 10 minutes to remove cell debris ...
-
bioRxiv - Cell Biology 2020Quote: ... of 100µM glyceraldehyde 3-phosphate (G3P, Sigma-Aldrich) for 30 min on poly-HEMA-coated plates at 37 degrees C ...
-
bioRxiv - Cell Biology 2020Quote: ... phosphatase inhibitors (Sigma cocktail 3, 1:100 dilution) and 100 nM okadaic acid ...
-
bioRxiv - Cell Biology 2020Quote: ... Sections were blocked in 3% H2O2 (Sigma Aldrich) for 20 min ...
-
bioRxiv - Cell Biology 2020Quote: ... supplemented with 3-isobutyl-1-methylxanthine (IBMX; Sigma) to inhibit phosphodiesterase cAMP degradation ...
-
bioRxiv - Cell Biology 2020Quote: ... [3-actin (Sigma Aldrich, A544l, dilution 1:10000), Oct 3/4 (Santa Cruz ...
-
bioRxiv - Cell Biology 2020Quote: ... Indole-3-acetic acid (IAA, auxin) (I5148; Sigma) was dissolved in ddH2O and used at a final concentration of 500 μM ...
-
bioRxiv - Genetics 2021Quote: ... followed by 3 washes in KSOM (Merck Millipore) medium droplets ...
-
bioRxiv - Neuroscience 2021Quote: ... and 1X Phosphatase Inhibitor Cocktail 3 (Sigma Aldrich). Cultured neurons were rinsed with ice-cold PBS and removed from coverslips in ice-cold RIPA buffer with a cell scraper ...
-
bioRxiv - Developmental Biology 2021Quote: ... then stained with hemotoxylin (Sigma GHS-3-32) and eosin (Sigma HT110-2-3 ...