Labshake search
Citations for Millipore Sigma :
2501 - 2550 of 10000+ citations for Human Dual Specificity Phosphatase 3 DUSP3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2020Quote: ... Alkaline phosphatase (ALP) from bovine intestinal mucosa was purchased from Sigma-Aldrich (Cat # P7923), further purified in house ...
-
bioRxiv - Synthetic Biology 2020Quote: Snap-frozen tumours were digested with radioimmunoprecipitation assay lysis buffer containing phosphatase inhibitors (Sigma). Protein concentrations were measured with a Pierce BCA protein assay (23227 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Tissues were homogenized in radioimmunoprecipitation assay buffer containing protease and phosphatase inhibitors (Sigma Aldrich). Homogenized samples were spun at 12000 g at 4°C for 20 minutes and western bots were run using 50 μg of protein electro-transferred to polyvinyl difluoride membrane ...
-
bioRxiv - Plant Biology 2020Quote: ... Secondary antibody (anti-rabbit IgG, whole molecule, alkaline phosphatase, Sigma, St. Louis, MO, USA), 200 μl of a 1:2000 dilution in PBS ...
-
bioRxiv - Genomics 2021Quote: ... before being incubated for 30 minutes with 1/500 ExtraAvidin-Alkaline Phosphatase (Sigma-Aldrich) in PBS containing 2% BSA ...
-
bioRxiv - Microbiology 2021Quote: ... The reaction was developed for 20 min with a phosphatase substrate (Sigma-Aldrich S0942). All sera were titrated in duplicate and titers were determined with absorbance at 405 nm in VERSAmax tunable microplate reader – Molecular Devices ...
-
bioRxiv - Biochemistry 2021Quote: ... and 1 mM ethylenediaminetetraacetic acid) supplemented with protease and phosphatase inhibitors (Sigma and Roche). Proteins were immobilized on PVDF membranes (Millipore ...
-
bioRxiv - Neuroscience 2020Quote: ... 0.5 mM EGTA) supplemented with 1% Triton X-100 and protease/phosphatase inhibitors (Millipore, Burlington ...
-
bioRxiv - Molecular Biology 2021Quote: ... 0.002 U phosphodiesterase I and 0.1 U alkaline phosphatase (Sigma-Aldrich, Saint-Louis, MO) and incubated further at 37 °C for 1 hour ...
-
bioRxiv - Developmental Biology 2020Quote: ... at RT for 2 h and BM purple alkaline phosphatase substrate (Sigma-Aldrich, 1144207001) was used to visualize the color in the humid chamber ...
-
bioRxiv - Cell Biology 2021Quote: ... the secondary antibody was goat anti-rabbit IgG conjugated with alkaline phosphatase (Sigma, A3687), and the membrane was incubated with BCIP/NBT chromogenic substrate (Sigma ...
-
bioRxiv - Cell Biology 2022Quote: ... and phosphatase and proteinase inhibitor cocktails (P5726 and P2714; Sigma-Aldrich/Merck group, USA), and scrapped ...
-
bioRxiv - Cell Biology 2022Quote: ... supplemented with 1:100 Halt protease and phosphatase inhibitor cocktail (Thermo) and benzonase (Novagen) at 12.5 U/mL ...
-
bioRxiv - Microbiology 2024Quote: ... The reaction was developed by adding the phosphatase substrate (Sigma 104; 1 mg/ml), and the absorbance was recorded at 405 nm ...
-
bioRxiv - Molecular Biology 2024Quote: ... bovine spleen phosphodiesterase and calf intestinal alkaline phosphatase (all from Sigma-Aldrich, Taufkirchen, Germany) as described previously (Schumacher et al ...
-
bioRxiv - Neuroscience 2023Quote: ... organoids were lysed with RIPA buffer supplemented with Protease and Phosphatase inhibitors (Sigma-Aldrich). Then ...
-
bioRxiv - Immunology 2023Quote: ... and lysed in radioimmunoprecipitation assay (RIPA) buffer supplemented with protease and phosphatase inhibitors (Sigma) for 2 min at 25 Hz at 4°C ...
-
bioRxiv - Cell Biology 2023Quote: ... combined with a secondary antibody α-rabbit-alkaline phosphatase (1:10,000, Sigma-Aldrich, A3687) and α-mouse-alkaline phosphatase (1:10,000 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.002 U phosphodiesterase I and 0.1 U alkaline phosphatase (Sigma-Aldrich, Saint-Louis, MO) and incubated further at 37 °C for 1 hour ...
-
bioRxiv - Cancer Biology 2022Quote: Cells were lysed in RIPA buffer supplemented with protease and phosphatase inhibitors (Roche (Sigma), 4906837001 ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 mM sodium orthovanadate and 1% (v/v) protease and phosphatase inhibitor cocktails (Sigma). Samples were clarified through centrifugation at 20,000 x g at 4°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1 µg/ml Pepstatin A and 500X dilution of phosphatase inhibitor cocktail 2 (Sigma)) ...
-
bioRxiv - Cell Biology 2023Quote: ... membranes were incubated with the respective alkaline phosphatase-conjugated goat secondary antibody (Sigma-Aldrich) for 1 h at room temperature (RT) ...
-
bioRxiv - Cell Biology 2024Quote: ... 1.0 % Na-Deoxycholate PH 7.2) containing a protease inhibitor and phosphatase inhibitor cocktails (Sigma). Protein concentrations were determined using the BCA protein assay kit (Pierce ...
-
bioRxiv - Cell Biology 2024Quote: ... containing ReadyShield® Protease and Phosphatase Inhibitor Cocktail (PPC- 2020, Millipore Sigma, Burlington, MA) on days 0 ...
-
bioRxiv - Bioengineering 2024Quote: ... in the presence of a protease and phosphatase inhibitor cocktail (Sigma, St. Louis, MO). Samples were sonicated 3 times for 15 s each cycle ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 1% Triton X-100) supplemented with protease and phosphatase inhibitor cocktail (Millipore-Sigma) and clarified lysates were harvested by centrifugation ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 1% Triton X-100) supplemented with protease and phosphatase inhibitor cocktail (Millipore-Sigma) and clarified lysates were harvested by centrifugation ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cells were harvested in ice-cold PBS containing protease and phosphatase inhibitors (Sigma-Aldrich). As exogenous control (spike-in) ...
-
bioRxiv - Immunology 2020Quote: Levels of nitrate and nitrite in plasma obtained from human and mice were estimated by a Griess colorimetric assay kit (Sigma chemicals) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... Secretion of the following cytokines was quantified with the MILLIPLEX® Human CD8+ T Cell Magnetic Bead Panel Premixed 17 Plex - Immunology Multiplex Assay kit (EMD-Millipore): IL-6 ...
-
bioRxiv - Immunology 2023Quote: ... EasySep™ Human CD56 Positive Selection Kit II) and were frozen down in CS10 CryoStor cell cryopreservation media media (Sigma-Aldrich).
-
bioRxiv - Neuroscience 2023Quote: ... and Aβ 1-42 using the Milliplex® MAP Human Amyloid Beta and Tau Multiplex Assay kit (Millipore Sigma HNABTMAG-68K). All kits were read on a MAGPIX® system (Luminex ...
-
bioRxiv - Immunology 2024Quote: Luminex assays detecting soluble ICAM-1 (sICAM1) were conducted using the MILLIPLEX Human Sepsis Magnetic Bead Panel 1 Kit (Millipore Sigma) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2020Quote: ... and histidine but supplemented with 2.5 mM 3-AT (3-Amino-1,2,4-triazole; Sigma) for 4 days at 28°C.
-
bioRxiv - Genomics 2019Quote: ... with primers 5’ GAGCTGGACGGCGACGTAAACG 3’ and 5’ CGCTTCTCGTTGGGGTCTTTGCT 3’ for amplification (Sigma-Aldrich, Germany). The PCR amplification was as follows ...
-
bioRxiv - Cell Biology 2019Quote: ... washed 3 times in PBS before incubation in PBS supplemented with 3% BSA (Sigma) for 30 min to block non-specific antibody binding ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.12 g (6.25 mmol) of 1-ethyl-3-(3-dimethyllaminopropyl) carbodiimide HCl (Sigma Aldrich) was added to the flask containing 0.98 g (2.7 mmol ...
-
bioRxiv - Plant Biology 2020Quote: ... (±)-3-Hydroxydecanoic acid (3-OH-C10:0) and chitin were obtained from Sigma-Aldrich. All elicitors were dissolved in deionized MilliQ sterile water at the respective stock concentration of 1mM for flg22Pa ...
-
bioRxiv - Neuroscience 2021Quote: ... histone 3 lysine 27 tri-methylation (H3K27me3) and histone 3 antibodies (all from Millipore). Positive bands were detected by chemiluminescent reagents (Thermofisher ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 3-uncoupled (3U) after sequential addition of 3 mM ADP (Sigma-Aldrich A5285), 4 μM oligomycin (Sigma-Aldrich C75351) ...
-
bioRxiv - Immunology 2022Quote: ... containing 0.25% with 3-[(3-cholamidopropyl) dimethylammonio]-1-propanesulfonate (CHAPS) (Sigma, St. Louis, MO) for two minutes at 37°C ...
-
bioRxiv - Immunology 2024Quote: ... 4% 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate hydrate (CHAPS; Sigma-Aldrich, Cat. No. 226947)] ...
-
bioRxiv - Developmental Biology 2023Quote: ... and (3) 3 hrs at RT in 0.1% Direct Red 23 (212490, Sigma-Aldrich), in PBST ...
-
bioRxiv - Neuroscience 2023Quote: ... Two pulse applications of 3 µM of GSK-3 Inhibitor CHIR99021 (Merck Millipore, 361571) were done on days 13 and 14 ...
-
bioRxiv - Biochemistry 2023Quote: ... and eluted with Cas1-2/3 Lysis Buffer containing 3 mM desthiobiotin (Sigma-Aldrich). Eluate was concentrated at 4°C (Corning Spin-X concentrators) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 98% EDC [1-(3-Dimethylaminopropyl)-3-ethyl carbodiimide hydrochloride] were purchased from Sigma Aldrich. SYBR Safe nucleic acid gel staining dye was obtained from Invitrogen (Fisher Scientific ...
-
bioRxiv - Developmental Biology 2022Quote: ... Two pulse applications of 3 μM of GSK-3 Inhibitor CHIR99021 (Merck Millipore, 361571) were done on days 13 and 14 ...
-
bioRxiv - Bioengineering 2022Quote: Human ovarian cancer A2780 and Adriamycin resistant human ovarian cancer A2780-R cells were procured from Sigma Inc ...
-
bioRxiv - Biochemistry 2022Quote: ... and another was loaded with 10 ng of human HSP70 (His tagged human HSP70, SRP5190, Millipore Sigma), which allowed comparisons to be made among separate gels ...