Labshake search
Citations for Millipore Sigma :
2451 - 2500 of 10000+ citations for Ceramide Synthase 3 CERS3 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... phosphatase inhibitor cocktail 2 and 3 purchased from Sigma Aldrich, MO ...
-
bioRxiv - Neuroscience 2024Quote: ... permeabilized for 30 min with 3% Triton-X (Millipore Sigma) in 1x PBS ...
-
bioRxiv - Bioengineering 2024Quote: ... and phase-separated in 1-bromo-3-chloropropane (B9673, Sigma) [82,95] ...
-
bioRxiv - Cancer Biology 2024Quote: ... followed by endogenous peroxidase inactivation with 3% H2O2 (Sigma-Aldrich) and subsequently blocked in 5% BSA in TBS-T with TBS washes inbetween each step ...
-
bioRxiv - Biochemistry 2024Quote: ... and 1 mM DTT supplemented with 3 mM ATP (Sigma) and 3 mM MgCl2 ...
-
bioRxiv - Immunology 2024Quote: ... reverse primer (5’-3’): GACGGTGCCATGGAATTTGC) and purchased from Sigma-Aldrich. RT-qPCR was performed with gene-targeted primers using TB Green Premix Ex Taq II (Tli RNase H Plus ...
-
bioRxiv - Immunology 2024Quote: ... 0.3% Triton X-100 and 3% Bovine Serum Albumin (Sigma). Cells were stained with antibodies for 30m-1h at room temperature or up to overnight at 4°C ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... and IBMX (3-Isobutyl-methylxanthine, 25µM, Sigma-Aldrich, Toluca Mexico) with ACSF was perfused for 25min ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3 mM MgCl2) containing 250 U/ml Benzonase (Sigma, E1014), 1X cOmplete EDTA-free protease inhibitor cocktail (Roche ...
-
bioRxiv - Immunology 2024Quote: ... and subsequently washed 3 times with PBS 2% FBS (Sigma). pDCs were enriched from freshly isolated PBMCs using the human Plasmacytoid Dendritic Cell Isolation Kit II (Miltenyi Biotec ...
-
bioRxiv - Bioengineering 2024Quote: ... a 2% 3-(Trimethoxysilyl)propyl methacrylate (TMSPMA, Sigma-Aldrich 440159) (v/v ...
-
bioRxiv - Cancer Biology 2022Quote: ... Primary antibodies were diluted in Duolink Antibody Diluent (Sigma) and incubated overnight at 4°C (See above) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Primary antibodies used: anti-puromycin antibodies (Millipore Cat#MABE343), anti-alpha-tubulin (Sigma Cat# T5168) ...
-
bioRxiv - Cell Biology 2021Quote: Primary antibodies used: anti-Flag M2 antibody (F1804, Sigma), anti-mouse Pericentrin (611814 ...
-
bioRxiv - Neuroscience 2022Quote: ... Antibodies used were: mouse anti-Olig2 antibody (Millipore, MABN50), rabbit anti-H3K4me3 antibody (Active motif ...
-
bioRxiv - Cell Biology 2020Quote: ... pan-polyglycylated antibody (mouse monoclonal antibody, AXO49, MABS276 Millipore), monoglycylated antibody (AXO 962 mouse monoclonal MABS277 ...
-
bioRxiv - Plant Biology 2021Quote: ... against a primary antibody (GST-tag Monoclonal antibody, Novagen), which is attached to GST-tagged TF proteins (Figure S4).
-
bioRxiv - Plant Biology 2020Quote: ... For secondary antibodies anti-mouse antibody (Sigma-Aldrich, UK), anti-rabbit (Sigma-Aldrich ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... The primary antibodies used were αSMA antibody from Sigma. The Aperio ScanScope XT Slide Scanner (Aperio Technologies ...
-
bioRxiv - Cell Biology 2024Quote: ... Primary antibodies: anti-LC3 antibody Atg8 (Merck Millipore #ABC975) (1:1000) ...
-
bioRxiv - Neuroscience 2022Quote: ... The primary antibodies used were: rabbit anti-Barhl1 polyclonal antibody (Atlas Antibodies, HPA004809, Sigma, 1:500), goat anti-Robo3 polyclonal antibody (R&D Systems ...
-
bioRxiv - Immunology 2020Quote: ... and product intensity measured by Software ImageJ(83) and normalized to ACTIN amplicon products (5’-GACGACATGGAGAAAATCTG-3’ and 5’-ATGATCTGGGTCATCTTCTC-3’, Sigma-Aldrich, St. Louis, Missouri, USA).
-
bioRxiv - Neuroscience 2021Quote: ... FW 5’ – CCA CAT GGG AGA GTC ACA T −3’ and RV 5’-ATA GCC TGG AAG CGG TCA GAT G −3’ (Sigma-Aldrich Japan, Inc., Tokyo, Japan). The PCR products (521 bp ...
-
bioRxiv - Bioengineering 2022Quote: ... crosslinking using 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC) (Carl Roth GmbH + Co. KG) and N-hydroxysuccinimide (NHS) (Sigma-Aldrich Chemie GmbH, Steinheim, Germany) was applied ...
-
bioRxiv - Microbiology 2022Quote: The AHL signaling molecules used in this study are N-(3-oxododecanoyl)-L-homoserine lactone (3-oxo-C12-HSL, Sigma-Aldrich CAS# 168982-69-2), N-butyryl-homoserine lactone (C4-HSL ...
-
bioRxiv - Neuroscience 2022Quote: ... BrdU injections were done 24h before sacrifice for the analysis at 3 dpKA and 3/7 days post administration of zinc (Cat#83265-250ML-F, Sigma-Aldrich, St Louis, MO, USA). To identify newborn cells at 14 dpKA ...
-
bioRxiv - Plant Biology 2024Quote: ... 2-(1H-Indol-3-yl)-4-oxo-4-phenyl-butyric acid (PEO-IAA; OlChemIm, Olomouc, Czech Republic) and indole-3-carbinol (I3C; Sigma-Aldrich, Merck KGaA, Darmstadt, Germany).
-
bioRxiv - Neuroscience 2023Quote: ... The sections were then dehydrated in ascending concentrations of ethanol for 5 min each (2[×[35%, 50%, 70%, 80%, 90%, 3[×[100%) and washed 3 times for 5 min with propylene oxide (Sigma-Aldrich, #cat 110205-18L-C). Next ...
-
bioRxiv - Genetics 2024Quote: ... and then incubated with primary antibodies (HIF-1α antibody, Cell Signaling 36169; TSPO antibody, ThermoFisher MA5-24844; Histone-H3 antibody, Millipore Sigma 05-499) diluted in the blocking buffer overnight at 4 °C ...
-
bioRxiv - Cell Biology 2020Quote: ... Secondary antibodies used included HRP-conjugated secondary antibodies (Sigma-Aldrich) and Alexa Fluor 488 ...
-
bioRxiv - Developmental Biology 2021Quote: ... The antibodies: Chicken anti-GFP antibody (ab16901, 1:500; Millipore), Mouse anti-Satb2 (ab51502 ...
-
bioRxiv - Cancer Biology 2019Quote: ... Primary antibodies were detected using HRP-conjugated secondary antibodies (Sigma) by chemiluminescence using Quantity One imaging software on a Bio-Rad Gel Docking system ...
-
bioRxiv - Cancer Biology 2021Quote: ... The conjugated antibodies were diluted with Candor Antibody Stabilizer (Sigma) and titrated to the optimal concentrations.
-
bioRxiv - Systems Biology 2020Quote: ... Antibodies used included: Rac1 antibody (Millipore, clone 238A, 1:500), anti-RhoA antibody (Santa Cruz Biotechnology 26C4 ...
-
bioRxiv - Neuroscience 2020Quote: The following antibodies were used: CryAB rabbit polyclonal antibody (Millipore, Cat# ABN185 ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-Sbp1 antibody (home-made) and anti-FLAG antibody(Sigma) for checking purity of protein and then used for binding studies.
-
bioRxiv - Microbiology 2022Quote: ... Primary antibodies (murine monoclonal ANTI-FLAG M2 antibody, Sigma-Aldrich #F1804 ...
-
bioRxiv - Cancer Biology 2019Quote: ... primary antibodies and anti-rabbit IgG secondary antibody (Sigma, NA934VS) according to standard techniques ...
-
bioRxiv - Biochemistry 2019Quote: ... 1 μL of antibody (α-Flag-M2 antibody, Sigma-Aldrich / α-HA ...
-
bioRxiv - Molecular Biology 2021Quote: ... V5 antibody (Thermo Pierce) and FLAG antibody (M2, Sigma-Aldrich) were diluted 1:5000 for use as the primary antibody ...
-
bioRxiv - Developmental Biology 2020Quote: ... primary antibodies and HRP-conjugated secondary antibodies (Cat# A9044, Sigma).
-
bioRxiv - Immunology 2024Quote: ... primary antibody (anti-human lactoferrin antibody, Sigma, Cat-No. L3262), secondary antibody (Goat-Anti-Rabbit Secondary Antibody ...
-
bioRxiv - Neuroscience 2023Quote: Polyclonal rabbit anti-CELF4 antibody (Prestige Antibodies, Sigma-Aldrich, HPA037986): Developed using CUGBP ...
-
bioRxiv - Microbiology 2023Quote: ... Secondary antibodies were goat anti-mouse IgG-peroxidase antibody (Sigma) for JL-8 and goat anti-rabbit IgG-peroxidase antibody (Sigma ...
-
bioRxiv - Plant Biology 2020Quote: ... GFP antibodies (Sigma) and Immun-Star Goat Anti-Rabbit (GAR)-HRP Conjugate antibody were used ...
-
bioRxiv - Neuroscience 2021Quote: ... primary antibody (Millipore); and anti-mouse NeuN (1:1000 for 12 h ...
-
bioRxiv - Neuroscience 2020Quote: ... SST antibody (Millipore, #MAB354 ...
-
bioRxiv - Molecular Biology 2019Quote: ... S9.6 antibody (Millipore) was added and samples were incubated overnight at 4° C with gentle rotation ...
-
bioRxiv - Microbiology 2022Quote: ... αFLAG antibody (Sigma) was used at 1:10,000 to detect Cap2-3×FLAG ...
-
bioRxiv - Genetics 2024Quote: ... Antibody (CTCF: Millipore 07-729 ...