Labshake search
Citations for Millipore Sigma :
2451 - 2500 of 10000+ citations for 3 1 3 Dioxan 2 yl 3' methoxypropiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... 700 µl of absolute ethanol and 1 µl of Pellet Paint (Novagen, 69049-3). RNA in the stop solution was chilled on dry ice for 5 min and then centrifuged at maximum speed for 20 min at 4 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA was phase separated with 0.1 µL/µL 1-bromo-3-chloropropane (Sigma #B9673) and then precipitated with with isopropanol (Sigma #I9516 ...
-
bioRxiv - Immunology 2024Quote: ... we mixed the samples with 200 µL of 1-bromo-3-chloropropane (Sigma Aldrich) and centrifuged at 4°C for 15 minutes at 16,000 x g ...
-
bioRxiv - Immunology 2024Quote: 1-3 x 105 cells/well were seeded in an ELISPOT plates (MSIPN4550, Millipore) in IMDM supplemented with 10 % SAB ...
-
bioRxiv - Plant Biology 2020Quote: ... supplemented with 10 g L−1 sucrose and 3 g L−1 phytagel (Sigma, Steinheim, Germany) or 8 g L−1 agar (Winkler ...
-
bioRxiv - Microbiology 2020Quote: ... 1 mg ml-1 of 3–5 kDa fluorescein isothio-cyanate (FITC)-dextran (Sigma-Aldrich, Germany) in phenol-red free DMEM/F12 medium (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2022Quote: ... The cleaned dishes were incubated with 1 mL of 1% (3-aminopropyl) triethoxysilane (APTES; Sigma Aldrich) in ethanol for 1hour at room temperature ...
-
bioRxiv - Developmental Biology 2020Quote: ... cells were infected with pLKO.1 control or pLKO.1-shZSCAN4 (5’-GAATGCAACAACTCTTGTAATCTCGAGATTACAAGAGTTGTTGCATTCT-3’, Millipore Sigma) and further selected with Puromycin (1ug/ml ...
-
bioRxiv - Biophysics 2024Quote: ... and sn-glycero-3-phosphocholine 1:1 cadmium chloride adduct were all purchased from Sigma-Aldrich, with the exception of acarbose ...
-
bioRxiv - Biophysics 2021Quote: ... The cantilevers were functionalized with amine groups by immersing in 2% (vol/vol) 3-aminopropyltriethoxysilane (Millipore Sigma) solution dissolved in acetone ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were incubated with 3 μg/ml DAPI (4’,6-diamidino-2-phenylindole; D8417 from Sigma Aldrich) for 15 min at RT ...
-
bioRxiv - Bioengineering 2021Quote: ... was added to the PEG solution followed by the addition of 1-[bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-oxide hexafluorophosphate] (HATU; 2.43 g, 6.4 mmol, 2 eq.; Sigma-Aldrich). Next ...
-
bioRxiv - Immunology 2022Quote: ... 2- or 3-days post fertilisation (dpf) zebrafish were anaesthetised in 0.168 mg/ml Tricaine (Sigma-Aldrich) in E3 media and visualised under a dissecting microscope ...
-
bioRxiv - Immunology 2021Quote: ... or 25 µM (L-3-trans-(Propylcarbamyl) oxirane-2-carbonyl)-L-isoleucyl-L-proline (CA-074me) (Sigma) to inhibit cathepsin B ...
-
bioRxiv - Biochemistry 2022Quote: ... and trans-4-Phenyl-3-buten-2-one (20a) were purchased from Sigma-Aldrich (St. Louis, MO). Ketoisophorone (2a ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3 mg total protein were mixed with 2 mL Urea Buffer (UB) (8 M urea (Sigma, U5128) in 0.1 M Tris/HCl pH 8.0 and 50mM ammonium bicarbonate) ...
-
bioRxiv - Cancer Biology 2020Quote: ... collected and lysed with NP-40 lysis buffer supplemented with phosphatase inhibitor cocktails 2 and 3 (Sigma) and protease inhibitor mix (Sigma) ...
-
bioRxiv - Biochemistry 2021Quote: ... phosphatase inhibitor cocktail 2 and phosphatase inhibitor cocktail 3 were purchased from Sigma-Aldrich (St. Louis, MO). All other chemicals including V8 protease were purchased from FUJIFILM Wako ...
-
bioRxiv - Neuroscience 2021Quote: ... A CRISPR-Cas9 crRNA (5’- GAGGCCAAGATGAGTACTGAGG-3’) targeting exon 2 of Blvra was synthesized by Sigma Aldrich. A single-stranded oligo homology template (5’-ATGGACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGATTACAAGGATGACG ATGACAAGATGAGCACGGAGGTGAGCTGCCCTCAGGGGCTGTAAGGGACACCTTTGCTG-3’ ...
-
bioRxiv - Cancer Biology 2021Quote: Polyacrylamide (PA) gels of varying stiffness (0.5, 2, and 5 kPa) were fabricated on 3-APTMS (Sigma) functionalized glass coverslips by combining 40% acrylamide and 2% bis-acrylamide in specific ratios as described previously [81] ...
-
bioRxiv - Neuroscience 2022Quote: ... The 2 odors used were 3-Oct (Sigma-Aldrich Cat# 218405-250G; CAS Number: 589-98-0) and MCH (Sigma-Aldrich Cat# 66360-250G ...
-
bioRxiv - Neuroscience 2022Quote: ... and blocked for 2 hours with blocking buffer (3% donkey serum in 0.1 M PBS; Sigma-Aldrich). Primary antibodies (ChAT ...
-
bioRxiv - Neuroscience 2022Quote: ... Internal solutions also contained 3-5mg/mL (0.3%-0.5%) of biocytin (Sigma-Aldrich, CAS# 576-19-2) which was added the day of recording.
-
bioRxiv - Systems Biology 2022Quote: ... The virus was collected both 2 days and 3 days later and 0.45 μm syringe filters (Millipore) were used to eliminate cells ...
-
bioRxiv - Microbiology 2022Quote: ... the cells were washed 3 times in PBS before addition of 2% Triton X–100 (Sigma-Aldrich) PBS solution to lyse the cells for enumeration of the intracellular bacteria ...
-
bioRxiv - Neuroscience 2022Quote: ... and ≥99% 4-methyl-3-heptanol and 99% 6-methyl-5-hepten-2-one from Sigma-Aldrich (Item numbers M48309 and M48805-100ML ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... phosphatase inhibitor cocktail 2 (P5726) and 3 (P0044) were purchased from Sigma-Aldrich (St. Louis, MO, USA), and Doxorubicin (Adriamycin ...
-
bioRxiv - Cell Biology 2024Quote: ... DLD1 cells were treated for 2 h with 0.5 mM 3-indoleacetic acid (Sigma, stock in ethanol). At the time points indicated ...
-
bioRxiv - Neuroscience 2024Quote: ... after 2-3 months of receiving HFD the mice were given 75 mg/kg STZ (Sigma-Aldrich) in 0.1M sodium citrate buffer ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2×105 KP cells (n=3) were plated in 6-well plates overnight in RPMI medium (Sigma). After 24 hours ...
-
bioRxiv - Plant Biology 2023Quote: ... 3-week-old plant leaves were infiltrated with 50 μM 2’,7’-dichlorodihydrofluorescein diacetate (H2DCFDA) (Millipore-Sigma) in 50 mM phosphate buffer (pH 7.4 ...
-
bioRxiv - Plant Biology 2023Quote: ... 3-week-old plant leaves were infiltrated with 50 μM 2’,7’-dichlorodihydrofluorescein diacetate (H2DCFDA) (Millipore-Sigma) in 50 mM phosphate buffer (pH 7.4 ...
-
bioRxiv - Cancer Biology 2023Quote: 2×105 KP cells (n=3) were plated in 6-well plates overnight in RPMI medium (Sigma). After 24 hours ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2×105 KP cells (n=3) were plated in 6-well plates overnight in RPMI medium (Sigma). After 24 hours ...
-
bioRxiv - Neuroscience 2023Quote: ... Patch pipettes (resistance 2-3 MΩ) were filled with an intracellular solution containing (mM): 110 CsMeSO3 (Sigma), 4.6 MgCl2 ...
-
bioRxiv - Neuroscience 2023Quote: ... 3-dione (CNQX) and 50 mM D,L-2-amino-5-phosphonovaleric acid (APV) acquired from Sigma to suppress post-synaptic responses ...
-
bioRxiv - Cancer Biology 2024Quote: Glass coverslips of 20×20 µm are coated with silane (2% (3-Trimethoxysil) propyl-methacrylate (Sigma #M6514)) ...
-
bioRxiv - Neuroscience 2024Quote: ... 8-cyclopentyl-1,3-dimethylxanthine (CPT; 3 nmol in 5 μl saline of 2% DMSO; #C102; Sigma-Aldrich; injection was given immediately before the start of exposure to restraint stress or 30 min before intrathecal injection of NA).
-
bioRxiv - Physiology 2024Quote: ... A 3:2 dilution of Oil Red O filtered solution (0.5 g/100 mL isopropanol; Sigma-Aldrich) was added to cells and incubated for 5 minutes at room temperature ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Phosphatase inhibitor cocktail 2 and phosphatase inhibitor cocktail 3 were purchased from Sigma-Aldrich (St. Louis, USA). Sequencing grade modified Trypsin (Trypsin ...
-
bioRxiv - Neuroscience 2024Quote: ... Figure 3 used 2 µL of 30 µm polystyrene beads (Polystyrene beads 30 µm, 84135, Millipore Sigma)mixed with NGM buffer solution to fully capture moving C ...
-
bioRxiv - Bioengineering 2024Quote: ... was added to the PEG solution followed by the addition of 1- [bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-oxide hexafluorophosphate] (HATU; 2.43 g, 6.4 mmol, 2 eq.; Sigma-Aldrich). Next ...
-
bioRxiv - Cell Biology 2024Quote: ... Monomer solution (1xPBS, 2 M NaCl, 8.625 % (w/w) Sodium acrylate (97 %, 744-81-3, Sigma Aldrich), 2.5 % (w/w ...
-
bioRxiv - Biochemistry 2024Quote: Samples for NMR spectroscopy were prepared by dissolving pectin (2–3 mg) in D2O (99.9% D, Sigma) with 60 nmol DSS-d6 (99% D ...
-
bioRxiv - Biophysics 2024Quote: ... The cantilever and CS were then washed with acetone and silanized with 2% 3-aminopropyltriethoxysilane (Millipore Sigma) in acetone for 30 minutes at room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... and then transferred to medium differing by the absence of histidine (his) and the presence of 5 mM 3-amino-1,2,4-triazole (3-AT; Sigma-Aldrich, Saint-Louis, MO, USA). Homologous recombination between pPC86 and the PCR product then reconstituted the expression cassette encoding the AD-fused prey protein ...
-
bioRxiv - Neuroscience 2024Quote: ... Tissue was mounted on charged slides and dried prior to ethanol washes (70%, 80%, 95%, 100% Ethanol, 3 minutes each) and washed in a histological clearing agent (Xylene substitute; Sigma Aldrich; 3 minutes), and then cover slipped with DPX mounting agent (Sigma Aldrich).
-
bioRxiv - Neuroscience 2023Quote: ... The excess fluorescent probe was removed through molecular weight and the buffer was exchanged with PBS (pH 7.4) using 3 kDa centrifugal filter units (UFC500396, Amicon® Ultra – 0.5mL, 3 kDa, Sigma-Aldrich®, Dublin, Ireland). Absorbance was measured at 555 and 280 nm for all tagged samples and calculations were performed according to manufacturer’s instructions using an arbitrary extinction coefficient of 100,000 and molecular mass of 100,000 SI unit ...
-
bioRxiv - Biophysics 2022Quote: ... SPR2 DNA encoding residues 649-864 was generated using the polymerase chain reaction method (primers: 5’-GGCAGGACCCATATGGGCAGGAGAGGGTGGGATAATAAAGC-3’ and 5’-GCCGAGCCTGAATTCTTACTTGTCGAACTGTTGGAGATCGATTTC-3’) and individually sub-cloned into pET28 (Millipore Sigma, Burlington, MA) using engineered NdeI and EcoRI restriction endonuclease sites ...
-
bioRxiv - Neuroscience 2021Quote: ... CS03iCTRn2 hPSCs were dissociated with Versene and colonies were transferred to an ultra-low attachment T-25 flask containing EZ sphere culture medium (a mixture of DMEM and F-12 medium in a 7:3 ratio supplemented with 1× B-27 supplement minus vitamin A [Life Technologies], 2 µg/mL heparin [Sigma-Aldrich] ...