Labshake search
Citations for Millipore Sigma :
201 - 250 of 10000+ citations for Mouse OLFR139 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... A shRNA scramble (SHC002, Sigma) was used as a control ...
-
bioRxiv - Cell Biology 2019Quote: The shRNAs targeting USP7 (Sigma), EZH2 ...
-
bioRxiv - Neuroscience 2019Quote: ... or scramble shRNA (Sigma, SHC202). For Bru-seq experiments ...
-
bioRxiv - Molecular Biology 2019Quote: Lentiviruses expressing shRNAs (Sigma-Aldrich Mission mouse or human Lentiviral shRNA libraries ...
-
bioRxiv - Cancer Biology 2020Quote: ... SHP2 (MISSION shRNA; Millipore-Sigma, TRCN0000327987 ...
-
bioRxiv - Immunology 2020Quote: ... human CtIP-specific shRNA (Sigma, TRCN0000318738 ...
-
bioRxiv - Cell Biology 2022Quote: ... and GAN shRNA (Sigma, TRCN0000083861) respectively ...
-
bioRxiv - Cell Biology 2022Quote: ... Pink1-shRNA (Sigma Cat# TRCN0000199446) and Control-shRNA (Sigma Cat# SHC016 ...
-
bioRxiv - Neuroscience 2024Quote: ... or MARK3 shRNA (Sigma, TRCN0000001564) were packaged into lentivirus by VectorBuilder ...
-
bioRxiv - Developmental Biology 2024Quote: ... shRNAs were bought from Sigma’s Mission Library (TRCN0000263127 and TRCN0000282500) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and non-targeting control shRNA (pLKO.1-puro non-Target shRNA Control; referred to as shCtrl) were obtained from Sigma (MISSION® shRNA Library), amplified ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 5μg lentiviral expression constructs shRNA (pLKO.1 Mission shRNA DNA clone, Sigma-Aldrich Inc.) or shMCU (#SHCLNG-NM_138357 Mission shRNA ...
-
bioRxiv - Cell Biology 2020Quote: ... non-target shRNA (SHC002) and eIF4E shRNA (SHCLND-NM_001968) and were purchased from Sigma Aldrich. shRNA to human raptor (plasmid#1857) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Stable lentiviral vectors expressing shRNA targeting MSI2 and control shRNAs were obtained from Sigma Aldrich (Mission lentiviral system ...
-
bioRxiv - Cell Biology 2021Quote: ... Lentiviral shRNA clones targeting Mapk6 and Makpakp5 were from the TRC1 shRNA library (Sigma-Aldrich): TRCN0000023199 for Mapk6 and TRCN0000024197 for Makpakp5 ...
-
bioRxiv - Cell Biology 2020Quote: ... Lamin B1 shRNA was expressed from pLKO.1 shRNA-LMNB1.71 puro (SHCLND-NM_005573, Sigma-Aldrich) containing the sequence ...
-
bioRxiv - Neuroscience 2022Quote: ... Silencing constructs encoding control shRNA and mfn2 shRNA (target sequence: TGGATGGACTATGCTAGTGAA) were purchased from Sigma (SHC202 and TRCN0000080612 respectively) ...
-
bioRxiv - Cell Biology 2023Quote: ... The following shRNAs were used in this study: Non-Targeting shRNA Controls (Sigma, Cat. # SHC002), shZNF598#1 (Sigma ...
-
bioRxiv - Cancer Biology 2023Quote: PDA530Met cells were transduced with control Scr shRNA (Non-Mammalian shRNA Control, SHC002, Sigma-Aldrich) or two independent shRNAs directed against the target gene ...
-
bioRxiv - Cancer Biology 2020Quote: ... two short hairpin RNAs (shRNA) targeting SLX4IP in the pLKO.1-puro lentiviral expression plasmid were purchased from Sigma (Clone ID NM_001009608.1-426s1c1 and NM_001009608.1-247s1c1) ...
-
bioRxiv - Microbiology 2020Quote: ... MDMs were transfected with plasmids that encoded either a mixture of three to five shRNAs directed against IRF8 (Sigma) or a mixture of control shRNAs (Sigma ...
-
bioRxiv - Molecular Biology 2020Quote: ... The total RNA was isolated from the hepatic cells grown after successful transfection of the plasmids containing shRNA molecules against both target genes as per the manufacturer’s protocol using Trizol (Sigma). The RNA samples were treated with DNase I (Fermentas ...
-
bioRxiv - Molecular Biology 2021Quote: ... 10 μg of Endonuclease G shRNA plasmid was transfected using linear/branched PEI (Polyethylenimine) polymer (Sigma, 1 mg/ml) (Longo et al. ...
-
bioRxiv - Cell Biology 2022Quote: Transfer plasmids with pre-designed shRNA against human Cdc42 mRNA were obtained from the Mission® TRC library (Sigma). Specifically ...
-
bioRxiv - Immunology 2023Quote: Protein expression was stably knocked down in Jurkat T cells by RNA interference using Mission shRNA plasmids (Sigma-Aldrich). Lentiviral particles were generated by transfecting HEK293T cells with pMD2G ...
-
bioRxiv - Cancer Biology 2024Quote: The shRNA plasmid (pLKO.1) for TP53 (TRCN0000003754) and TRIM28 (TRCN0000017998) were obtained from the TRC library (Sigma, IISc). The TRIM28 3’ UTR Luc vector plasmid was purchased from Origen ...
-
bioRxiv - Cancer Biology 2023Quote: ... pLKO.1-puro shRNA plasmid DNA was isolated from bacteria glycerol stocks (IFNAR1: TRCN0000301483, PD-L1: TRCN0000068001; Sigma Aldrich) using E.Z.N.A.® Plasmid Mini Kit I (Omega Bio-tek ...
-
bioRxiv - Cell Biology 2024Quote: ... according to the manufacturer’s instructions with 18 µg of the following plasmid cocktail: lentiviral shRNA constructs from Sigma Aldrich (shPARP14 TRCN0000290897 and TRCN0000296754 or shp62 TRCN0000007237 and TRCN0000007236) ...
-
bioRxiv - Cancer Biology 2024Quote: ... shRNAs that stably integrated into mouse cells were chosen through selection with 10 μg/ml puromycin (Sigma). For the generation of Nat10-overexpressing cells ...
-
bioRxiv - Evolutionary Biology 2021Quote: The HIV-derived lentiviral vector pLKO.1 containing shRNAs (TRIM17 MISSION shRNA Bacterial Glycerol Stock, Sigma) that targeted Trim17 (shTrim17-1 ...
-
bioRxiv - Cell Biology 2021Quote: Control or Myo10 shRNA knockdown C2C12 lines were made using MISSION shRNA lentiviral particles (Sigma-Aldrich No ...
-
bioRxiv - Cell Biology 2021Quote: ... 4EBP1 shRNA (TRCN0000335449) and EIF4G1 shRNA (TRCN0000096812) targeting the Coding Sequence (CDS) were all from Sigma. Lentiviral backbone pLV-EF1a-IRES-Neo was a gift from Tobias Meyer (Addgene plasmid #85139) ...
-
bioRxiv - Immunology 2021Quote: shRNA clones were obtained from the whole RNAi human library for shRNA mediating silencing (Sigma, Aldrich) maintained at IISER ...
-
bioRxiv - Cancer Biology 2024Quote: shRNA constructs targeting METTL3 and control shRNA in the pLKO.1 vector were procured from Sigma. To generate lentiviral particles for each shMETTL3 and control shRNA construct ...
-
bioRxiv - Biophysics 2021Quote: ... A non-targeting shRNA (Sigma SHC216) was used as a control.
-
bioRxiv - Immunology 2021Quote: ... or control shRNAs for GFP (Sigma) and luciferase (Sigma ...
-
bioRxiv - Developmental Biology 2020Quote: pLKO1 vector containing shRNA (Sigma Aldrich) and H2b-GFP plasmids (gift from Elaine Fuchs ...
-
bioRxiv - Biochemistry 2019Quote: ... the most effective shRNA (TRCN0000007273; Sigma) for lentiviral infection were used for experiments ...
-
bioRxiv - Cancer Biology 2019Quote: ... pLKO.1-non-targeting shRNA (Sigma; 5’- CCT AAG GTT AAG TCG CCC TCG CTC GAG CGA GGG CGA CTT AAC CTT AGG -3’) ...
-
bioRxiv - Cancer Biology 2020Quote: ... non-mammalian shRNA sequences (Sigma SHC002) were cloned into Tet-pLKO-puro vectors by using oligo (5’-3’) ...
-
bioRxiv - Neuroscience 2020Quote: ... non-targeted shRNA (SHC016, Sigma-Aldrich), or empty vector plko.1 lentivirus ...
-
bioRxiv - Cancer Biology 2021Quote: Mission shRNA vectors purchased from Sigma were transiently transfected along with pCMV-VSVG and ps-PAX2 into HEK 293T cells using polyethylenimine (PEI ...
-
bioRxiv - Cancer Biology 2022Quote: ... shRNAs targeting ERF (Sigma-Aldrich: TRCN000001391) and lentiviral GFP-tagged ERF (GeneCopoeia ...
-
bioRxiv - Cancer Biology 2022Quote: ... pLKO.1 HIF2α shRNA (#TRCN0000082307, Sigma).
-
bioRxiv - Biochemistry 2020Quote: ... The shRNAs used were from Sigma shRNA clone library which were identified by TRC numbers.
-
bioRxiv - Cancer Biology 2021Quote: ... Vectors encoding for random shRNA (Sigma) were used as a control ...
-
bioRxiv - Immunology 2020Quote: ... and human RNF20-specific shRNA (Sigma, TRCN0000033876 ...
-
bioRxiv - Neuroscience 2021Quote: ... TurboGFP-targeting shRNA (SHC004 Sigma-Aldrich) and a universal non-targeting shRNA (LV015-G ABM ...
-
bioRxiv - Cancer Biology 2020Quote: ... A non-target shRNA (shNT) (Sigma MISSION shRNA non-mammalian control SHC002 ...
-
bioRxiv - Cell Biology 2022Quote: ... LentiCRISPRv2 vector with predesigned shRNA (Sigma mission shRNA TRCN0000312779 ...