Labshake search
Citations for Millipore Sigma :
201 - 250 of 8703 citations for Human Cathepsin B ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... The DNA fragmentation assay used the Cell Death Detection ELISA kit (initially from Roche, later Millipore-Sigma). Phosphatidylserine was detected by FITC-conjugated annexin V (Sigma) ...
-
bioRxiv - Cancer Biology 2020Quote: ... All cell lines tested and confirmed to be mycoplasma free using the Mycoplasma PCR ELISA kit (Sigma). CENP-A overexpression was induced by the addition of Dox to typical growth media at 10ng/ml (considered 1X) ...
-
bioRxiv - Neuroscience 2021Quote: ... The BDNF of offspring hippocampus was measured using the ChemiKineTM BDNF Sandwich ELISA kit (CYT306; Chemikine, Millipore). A total of 80 µg/well of hippocampus protein was used and samples were analysed in duplicates ...
-
bioRxiv - Cell Biology 2019Quote: ... The CRP concentration in mouse serum was measured using the mouse CRP ELISA kit (Sigma-Aldrich, RAB1121) according to the manufacturer’s protocol.
-
bioRxiv - Microbiology 2021Quote: Cell proliferation activity was measured by BrdU incorporation assay using a Cell Proliferation ELISA kit (Sigma-Aldrich). The wells of 96-well plates were seeded with 5000 HSC-2 or HO-1-N-1 cells ...
-
bioRxiv - Genetics 2021Quote: ... leptin and adiponectin were measured in plasma from fasted mice using ELISA kits from Millipore (EZRMI-13K), Mercodia (10-1281-01) ...
-
bioRxiv - Neuroscience 2024Quote: Neuropeptide Y levels in tissue were measured with commercially available ELISA kit (EMD Millipore, EZHNPY-25 K). Mice were anesthetized with isoflurane and euthanized by decapitation ...
-
Caloric restriction prevents inflammation and insulin dysfunction in middle-aged ovariectomized micebioRxiv - Physiology 2023Quote: ... Insulin serum was measured using ELISA (Rat/Mouse Insulin ELISA, #EZRMI-13K, Millipore St. Charles, MO, USA)) ...
-
bioRxiv - Microbiology 2022Quote: ... purified bacterial cultures (B. adolescentis and B. fragilis at 107CFU/ml) or putrescine (Sigma) diluted to final concentrations of 33/66/100mM ...
-
bioRxiv - Cancer Biology 2024Quote: ... Following amplification cells were washed for 15 min with wash buffer B (Sigma Duolink PLA kit) and incubated with Hoechst for 5 min before another 15 min wash with buffer B ...
-
bioRxiv - Immunology 2021Quote: ... shCASP8-B (Sigma SHCLND, TRCN0000376481): GGAGCTGCTCTTCCGAATTAA ...
-
bioRxiv - Developmental Biology 2021Quote: ... 0.540g B glycerophosphate (Sigma G9422), 0.092g Na3VO4 (Sigma 450243) ...
-
bioRxiv - Cell Biology 2022Quote: ... Latrunculin B (L5288 from Sigma), 5µM ...
-
bioRxiv - Genomics 2019Quote: ... and B-actin (A5441, Sigma) were used at dilution 1:1000 and 1:5000 ...
-
bioRxiv - Genomics 2020Quote: ... 0.1mM b-mercaptoethanol (Sigma-Aldrich), 2mM L-glutamine (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2019Quote: ... amphotericin B (Sigma - Aldrich, Germany) (from 0.125 to 16 µg/mL) ...
-
bioRxiv - Cell Biology 2019Quote: ... Latrunculin B (Sigma, 5 µM) was added to the culture media for 10 min before 20 min of rapamycin ...
-
bioRxiv - Microbiology 2021Quote: ... and polymyxin B (Sigma-Aldrich), were serially diluted 1 in 2 ...
-
bioRxiv - Cell Biology 2021Quote: ... antifoam B (Sigma, 1:5000), and 40U/mL RNAsin (Promega)) ...
-
bioRxiv - Microbiology 2021Quote: ... 2.5μg/mL Polymyxin B (Sigma) was used as permeabilizing agent in the positive control ...
-
bioRxiv - Cell Biology 2021Quote: ... and 0.1% amphotericin B (Sigma). Spinner-adapted L929 cells (originally obtained from the Bernard Fields laboratory ...
-
bioRxiv - Cell Biology 2020Quote: ... 1:5000 Antifoam B (Sigma) and lysed by vortexing with acid-washed glass beads for 2 min followed by 2 min on ice for three cycles ...
-
bioRxiv - Genomics 2022Quote: ... 0.1 mM b-mercaptoethanol (Sigma) and 1000 U/mL of LIF (Chemicon) ...
-
bioRxiv - Neuroscience 2021Quote: ... rhodamine B (RhoB; Sigma Aldrich), Rp-8-Br-PET-cGMPS ...
-
bioRxiv - Neuroscience 2021Quote: ... followed by pestle B (Sigma), and filtered through a 70-um cell strainer (Fisher Scientific) ...
-
bioRxiv - Cell Biology 2019Quote: ... b-actin (Sigma, AC-15), P-eIF2a (Abcam ...
-
bioRxiv - Developmental Biology 2019Quote: ... 200 nM b-mercaptoethanol (Sigma), 1 % sodium pyruvate (Thermo Scientific) ...
-
bioRxiv - Cell Biology 2019Quote: ... B-Actin (A1978; Sigma-Aldrich).
-
bioRxiv - Immunology 2020Quote: ... Amphotericin B (all Sigma-Aldrich), and BD Difco™ BBL™ Middlebrook ADC Enrichment and incubated at 37 °C with agitation with a magnetic stir bar ...
-
bioRxiv - Microbiology 2019Quote: As hygromycin B (Sigma-Aldrich) was used as the selection marker during transformations ...
-
bioRxiv - Microbiology 2020Quote: ... Polymyxin B nonapeptide (PMBN; Sigma), a non-toxic polymyxin derivative ...
-
bioRxiv - Cell Biology 2021Quote: ... Rhodamine B solution (Sigma, 02558) was diluted to 10% in water and image stacks were acquired in the red channel during laser application ...
-
bioRxiv - Cancer Biology 2021Quote: ... Amphotericin B (Sigma, Cat#:A2942) at 250µg/ml ...
-
bioRxiv - Cancer Biology 2020Quote: ... and B-ACTIN (Sigma A5441).
-
bioRxiv - Cell Biology 2021Quote: ... and 0.1% amphotericin B (Sigma) or infection medium (growth medium containing 2% FBS) ...
-
bioRxiv - Microbiology 2020Quote: ... and 0.1% amphotericin B (Sigma). SV-40 immortalized endothelial cells (SVECs ...
-
bioRxiv - Developmental Biology 2021Quote: ... Rhodamine B (Sigma, Cat R8881) was co-injected with MOs as a dye ...
-
bioRxiv - Bioengineering 2022Quote: ... amphotericin-B (0.2 mL, Sigma), and cell medium (6.75 mL) ...
-
bioRxiv - Immunology 2022Quote: ... Staphylococcus enterotoxin B (SEB; Sigma) stimulation (200ng/ml ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and amphotericin B (Sigma-Aldrich) was performed by determining the minimal inhibitory concentration (MIC ...
-
bioRxiv - Neuroscience 2022Quote: ... 1.1ug/mL Amphotericin B (Sigma), 20ug/mL gentamycin (Sigma ...
-
bioRxiv - Neuroscience 2022Quote: ... 1.1ug/mL Amphotericin B (Sigma), 20ug/mL gentamycin (Sigma ...
-
bioRxiv - Neuroscience 2022Quote: ... 1.1ug/mL Amphotericin B (Sigma), 20ug/mL gentamycin (Sigma) ...
-
bioRxiv - Neuroscience 2022Quote: ... B hardener (44612, Sigma-Aldrich); D hardener (44614 ...
-
bioRxiv - Microbiology 2022Quote: ... and polymyxin B (Sigma-Aldrich) was prepared to 50 mg ml-1 in dH2O ...
-
bioRxiv - Genomics 2022Quote: ... 0.1mM b-mercaptoethanol (Sigma-Aldrich), 2mM L-glutamine (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2023Quote: ... Latrunculin B (Sigma #L5288-1MG) at a final concentration of 10 μM was added to the media.
-
bioRxiv - Microbiology 2022Quote: ... amphotericin B (Sigma-Aldrich, #A9528) (0.03-16 μg/ml) ...
-
bioRxiv - Cell Biology 2023Quote: ... cytochalasin B (Millipore-Sigma, #C6762), cytochalasin D (Millipore-Sigma ...
-
bioRxiv - Neuroscience 2023Quote: ... b-Actin (Sigma-Aldrich, A5316), Progranulin (Thermo Fisher Scientific ...