Labshake search
Citations for Millipore Sigma :
201 - 250 of 10000+ citations for 7 Methyl 1 5 dioxo 1 2 3 5 tetrahydro indolizine 6 carbonitrile since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... samples were treated with 5 mM Methyl-β-cyclodextrin (Sigma-Aldrich) diluted in 10 μM Lovastatin (Sigma-Aldrich ...
-
bioRxiv - Biophysics 2021Quote: ... were purchased from Sigma-Aldrich and solved in 5% (w/v) methyl-β-cyclodextrin (Sigma Aldrich).
-
bioRxiv - Immunology 2022Quote: ... mBECs were pretreated with 5 nM methyl-ß-cyclodextrin (Sigma C4555) for 1 hr prior to incubation with CD4+ T cells ...
-
bioRxiv - Cell Biology 2019Quote: ... 3 μL of 1× ligand (Tris[(1-benzyl-1H-1,2,3-triazol-4-yl)methyl]amine (Sigma-Aldrich) 20% DMSO in t-butanol) ...
-
bioRxiv - Cell Biology 2022Quote: ... Methyl blue 1 min (Sigma). Between different stains slides were washed with dH2O ...
-
bioRxiv - Neuroscience 2021Quote: ... 1% methyl salicylate (Sigma W274502), 1% (+)-carvone (Sigma 22070) ...
-
bioRxiv - Neuroscience 2022Quote: ... and 4′,6-Diamidino-2-phenylindole dihydrochloride (DAPI) for 3 min (1:5000, Sigma Aldrich), and mounted in prolong gold (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2021Quote: 5-aza-2’-deoxycytidine (5-AzadC, A3656) and epigallocatechin-3-gallate (EGCG, E4143) were purchased from Sigma Aldrich. Antibodies against CREB (sc-186) ...
-
bioRxiv - Cell Biology 2020Quote: ... 5-Fluorouridine (1 mM) (Sigma) was added in the culture media 15 min before fixation ...
-
bioRxiv - Neuroscience 2021Quote: ... α5 (1:250, Millipore #AB9678), β3 (1:250 ...
-
bioRxiv - Biochemistry 2019Quote: 2 µl of 1 mM 2’,7’ Dichlorofluorescein diacetate (Sigma-Aldrich) dissolved in DMSO was added to 198 µl of cell culture in a black f-bottom 96 well plate (Greiner bio-one ...
-
bioRxiv - Plant Biology 2020Quote: ... and anti-α-tubulin antibodies (clone B-5-1-2, Sigma-Aldrich) at 1:5000 ...
-
bioRxiv - Neuroscience 2019Quote: ... mouse anti-alpha-tubulin ([B-5-1-2], Sigma, T5168, RRID AB_477582) and ATTO647N-conjugated anti-GFP nanobodies (GFPBooster-ATTO647N ...
-
bioRxiv - Cell Biology 2020Quote: ... α-Tubulin (T5168, Clone B-5-1-2) was from Sigma Aldrich.
-
bioRxiv - Biochemistry 2021Quote: A monoclonal anti-α-tubulin (SIGMA, T5168, Clone B-5-1-2) was used in western blots as a loading control ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 mg·ml-1 iodoacetamide and 5 U/l Salt Active Nuclease (Sigma) for 1 h at 4 °C ...
-
bioRxiv - Synthetic Biology 2020Quote: ... cells were also treated with 1 μM 5-Aza-2’-deoxycytidine (Sigma) or 100 nM chaetocin (Cayman Chemical) ...
-
bioRxiv - Immunology 2022Quote: ... or α-Tubulin (clone B-5-1-2, Sigma-Aldrich, Cat#T5168). Primary antibodies were revealed with IRDye® 680 Goat anti-Mouse IgG or IRDye® 800CW Goat anti-Rabbit IgG (LI-COR ...
-
bioRxiv - Molecular Biology 2023Quote: ... and anti-α-tubulin B-5-1-2 monoclonal primary (T5168, Sigma), followed by goat-anti mouse IRDye 680 goat anti-mouse IgG secondary antibodies (926-68070 ...
-
bioRxiv - Microbiology 2023Quote: ... and pretreated 1 h at 37°C with either 5 mM Methyl-β-cyclodextrin (MBCD) (Sigma Aldrich, stock in ddH2O) in OptiMEM medium buffered with 25 mM HEPES (Sigma Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: ... or 5-Aza (6 μM, Sigma) into L-ESCs culture medium.
-
bioRxiv - Evolutionary Biology 2023Quote: ... with 2 mg/mL of fluorescein-5(6)-isothiocyanate (Sigma-Aldrich, Miss, USA). The samples were then incubated in the dark at room temperature ...
-
bioRxiv - Microbiology 2022Quote: 7 mmol ABTS (2,2’-azinobis-(3-ethylbenzothiazoline-6-sulfonic acid, Sigma) stock solution was mixed with 2.45 mmol potassium persulfate (K2S2O8 ...
-
bioRxiv - Neuroscience 2020Quote: ... N-methyl-DL-aspartic acid (NMA) and 5-hydroxytryptamine creatinine sulfate (5-HT) were obtained from Sigma-Aldrich. Other drugs ...
-
bioRxiv - Physiology 2022Quote: ... respiration was measured in response to either 5 mM pyruvate or 5 mM methyl pyruvate (371173, Sigma Aldrich) along with the above substrates.
-
bioRxiv - Genomics 2019Quote: ... with primers 5’ GAGCTGGACGGCGACGTAAACG 3’ and 5’ CGCTTCTCGTTGGGGTCTTTGCT 3’ for amplification (Sigma-Aldrich, Germany). The PCR amplification was as follows ...
-
bioRxiv - Neuroscience 2023Quote: ... 3-methyl cyclopentanone (Sigma, 157643) were placed in 50 ml glass bottles ...
-
bioRxiv - Microbiology 2021Quote: Adult female worms were incubated with 5 μM of 5’ cy3-labeled Bma-lad-2 siRNA 1 (Sigma Aldrich) for 24 hrs to evaluate uptake of siRNA into intestinal tract epithelial cells ...
-
bioRxiv - Neuroscience 2020Quote: ... Bacterial pellets of 20 OD600 units were lysed in 0.5 ml cold lysis buffer (50 mM Sodium-phosphate pH 8.0, 300 mM NaCl, 5% glycerol, 5 mM 2-Mercaptoethanol, 1 mM PMSF [Sigma]), RNase [0.01 mg/ml] ...
-
bioRxiv - Neuroscience 2020Quote: ... 5 mM 5-Fluro-2’-deoxyuridine (SIGMA U3003). Cells were transfected at DIV17-19 with Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Neuroscience 2021Quote: ... and 5’-fluoro-2’-deoxyuridine (Sigma, 5 μM) were added to the culture medium at days in vitro (DIV ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 mM 5-Fluro-2’-deoxyuridine (SIGMA U3003). Cells were transfected at DIV17-19 with Lipofectamine 2000 (Invitrogen ...
-
Optimized immunoglobulin knock-ins using Cas9 reveal peritoneal B cell lineage relationships in vivobioRxiv - Immunology 2021Quote: ... followed by HCG 5-7 IU (Sigma CG5) 47 hrs ...
-
bioRxiv - Neuroscience 2021Quote: ... mouse α-tubulin clone B-5-1-2 (1:1000; Sigma Aldrich, San Luis, MO, U.S.). For immunofluorescence primary antibodies were labeled with Alexa-conjugated secondary antibodies Alexa 488 ...
-
bioRxiv - Molecular Biology 2023Quote: ... supplemented with 1:10000 dilution of anti-mouse alpha-Tubulin (Clone B-5-1-2; SIGMA) for 1 to 3 h at room temperature ...
-
bioRxiv - Microbiology 2019Quote: ... and [5-(2-thienyl)-3-isoxazolyl]methanol were obtained from Sigma-Aldrich, MO (Table 1) ...
-
bioRxiv - Microbiology 2024Quote: ... 5 g L−1 1-butanol (Sigma-Aldrich), 5 g L−1 hexanol (Sigma-Aldrich) ...
-
bioRxiv - Molecular Biology 2023Quote: ... siZWINT (Sigma, 5’-GCACGUAGAGGCCAUCAAA-3’). RNAiMAX (Invitrogen ...
-
bioRxiv - Molecular Biology 2020Quote: ... The pellets were resuspended at an OD600 of 1 in 5 ml of agroinfiltration buffer (10 mM MgCl2 and 250 μM of 3’,5’-Dimethoxy-4’-hydroxyacetophenone (Sigma-Aldrich)) ...
-
bioRxiv - Bioengineering 2022Quote: ... HA-TBA was dissolved in anhydrous DMSO (2 wt%) with a 3:1 M ratio of 5-norbornene-2-carboxylic acid (mixture of endo and exo isomers; Millipore-Sigma) to HA-TBA repeat units ...
-
bioRxiv - Cancer Biology 2022Quote: Cell proliferation was assessed by the colorimetric assay of sulforhodamine B 2-(3-diethylamino-6-diethylazaniumylidene-xanthen-9-yl)-5-sulfo-benzenesulfonate (SRB) (Sigma Aldrich, USA)[25] ...
-
bioRxiv - Biochemistry 2019Quote: ... and csm5 were cloned into pACYCDuet-1 (5’-NcoI, 3’-XhoI; Novagen, Merck Millipore), csm4 was cloned into pEHisTEV (5’-NcoI ...
-
bioRxiv - Biochemistry 2019Quote: ... and csm5 were cloned into pACYCDuet-1 (5’-NcoI, 3’-XhoI; Novagen, Merck Millipore), csm4 was cloned into pEHisTEV (5’-NcoI ...
-
bioRxiv - Genetics 2023Quote: ... beads were rewashed 3 times 5 minutes with 1× wash buffer (Sigma-Aldrich, W0390) on a rotator and with protease and phosphatase inhibitors ...
-
bioRxiv - Cancer Biology 2023Quote: ... from QIAGEN or costume siRNA against MdmX (siMdmX#1, sequence: 5’-AGAUUCAGCUGGUUAUUAA-3’) from Sigma-Aldrich. For Spry4 knockdown cells were transfected with a pool of 3 siRNAs against Spry4 (s37824 ...
-
bioRxiv - Developmental Biology 2022Quote: ... inflorescences from 3-week-old plants were treated with 5 μM 6-BA (Sigma-Aldrich), 50 μM IAA (Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2023Quote: ... and 3 μg/mL + 7 μg/mL FRD+U (5-Fluoro-2′-deoxyuridine, Sigma-Aldrich, Cat# F0503 and Uridine, Sigma-Aldrich, Cat# U3003-5G). 120 µL of cell suspension was carefully plated onto each coverslip and allowed to adhere for 2 hours at 37°C and 5% CO2 ...
-
bioRxiv - Biophysics 2019Quote: ... Cells were treated with 5 mM Methyl-β-CycloDextrin (MBCD; C4555, Sigma), 100 μg/ml Water-soluble Cholesterol/MBCD complex (C4951 ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 x 10 min 100% EtOH) and cleared (3 x 5 min) in xylene (247642, CAS: 1330-20-7, Sigma Aldrich). Finally ...
-
bioRxiv - Cell Biology 2023Quote: ... Bottom coverslips are activated with a 2% 3-Aminopropyltrimethoxysilane (3-APTMS) (Sigma Aldrich 13822-56-5) in 96% ethanol solution for 5 minutes and washed with 70% ethanol ...