Labshake search
Citations for Millipore Sigma :
2351 - 2400 of 10000+ citations for PD 1 Human C93S HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... blocking of Fc receptors with human Ig (Sigma-Aldrich, St. Louis, MO); surface staining with mouse anti-human CD3-APC-H7 ...
-
bioRxiv - Immunology 2023Quote: ... Fc receptors were blocked with 10% normal human AB serum (Sigma-Aldrich). For analysis of neutrophil activation ...
-
bioRxiv - Molecular Biology 2023Quote: ... human TLR3 (forward: FH2-TLR3; CAACAGAATCATGAGACAGAC; reverse: RH2-TLR3; CACTGTTATGTTTGTGGGTAG; Millipore Sigma), GUSB (forward ...
-
bioRxiv - Immunology 2023Quote: ... Fc receptors were blocked with 10% normal human AB serum (Sigma-Aldrich). To enrich for MSCs ...
-
bioRxiv - Immunology 2023Quote: ... Fc receptors were blocked with 10% normal human AB serum (Sigma-Aldrich). After blocking ...
-
bioRxiv - Bioengineering 2023Quote: ... Human serum albumin (HSA, A1653) was purchased from Sigma-Aldrich (The Netherlands). Unless noted otherwise ...
-
bioRxiv - Cell Biology 2023Quote: ... the epididymal sperm were incubated in human tubular fluid (HTF; EMD Millipore) at 2.0 x 106 cells/ml concentration for 90 minutes at 37 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... human Epidermal Growth Factor (hEGF, Cat# 62253-63-8, Sigma-Aldrich, USA), human Transforming Growth Factor-α (hTGF-α ...
-
bioRxiv - Immunology 2023Quote: ... were coated overnight at 4°C with anti-human Fab (Millipore Sigma) diluted 1:500 in PBS ...
-
bioRxiv - Neuroscience 2023Quote: ... supplemented with human epidermal growth factor (hEGF) (20 ng/ml, Sigma E9644) and human fibroblast growth factor 2 (hFGF2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... human Transforming Growth Factor-β1 (hTGF-β1, Cat# T7039, Sigma-Aldrich, USA), Fibroblast Growth Factor 1 (FGF1 ...
-
bioRxiv - Genetics 2023Quote: ... Human ESCs were lysed with 50-100 µL of RIPA buffer (Sigma) supplemented with 1x Complete EDTA-free Protease Inhibitor cocktail (Roche) ...
-
bioRxiv - Microbiology 2023Quote: ... Human interferon-β recombinant protein was purchased from Millipore (St. Louis, MO), and for stimulation ...
-
bioRxiv - Immunology 2023Quote: ... the patterned surface was coated with 2.5% human collagen (Sigma #C5533-5MG) diluted in water for 1 h at RT ...
-
bioRxiv - Immunology 2023Quote: ... single stranded DNA (ssDNA, prepared from dsDNA) and human insulin (Sigma, I9278) by ELISA as described (Gitlin et al. ...
-
bioRxiv - Cancer Biology 2023Quote: ... PANC0813 medium was supplemented with 10units/mL human recombinant insulin (Sigma-Aldrich), and MHHNB11 medium was supplemented with MEM Non-Essential Amino Acids (Sigma-Aldrich) ...
-
bioRxiv - Immunology 2022Quote: Human neutrophils were isolated by layering whole blood over Histopaque-1119 (Sigma) followed by a discontinuous Percoll gradient (Amersham Biosciences ...
-
bioRxiv - Immunology 2022Quote: Human 38-plex magnetic cytokine/chemokine kits (EMD Millipore, HCYTMAG-60K-PX38) were used per manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2023Quote: ... Human LDL (hLDL) was purchased from Sigma-Aldrich (St. Louis, MO, USA). Fluorescein isothiocyanate (FITC)-conjugated anti-CD41 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 12µL human insulin (final concentration 2.375-2.875µg/mL, Sigma Aldrich I9278) were added to make SXO HPLM ...
-
bioRxiv - Cell Biology 2023Quote: ... pre-coated with 10 μg/ml Human Plasma Fibronectin (Sigma-Aldrich, FC010). Neurons were mechanically shaken off and removed by patting the flask approximately 2 days after inoculation ...
-
bioRxiv - Molecular Biology 2023Quote: The human megakaryoblast leukemic cell line MEG-01 (Sigma-Aldrich, ECACC 94012401) was maintained in RPMI 1640 Medium + GlutaMAX™-I (Gibco™ – Thermo Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... Fresh citrate-anticoagulated human blood was pre-labeled with Mepacrine (Sigma-Aldrich) for 10 min at RT and perfused over the pre-coated coverslips using a flow chamber system (50 µm x 5 mm ...
-
bioRxiv - Immunology 2023Quote: ... followed by injection of 6.5 U human chorionic gonadotropin (hCG; Sigma-Aldrich) 48 h later ...
-
bioRxiv - Cell Biology 2024Quote: Human retinal pigment epithelial (RPE) cells were cultured in DMEM (Sigma, #D5648) supplemented with 10% fetal bovine serum and maintained at 37°C with 5% CO2 ...
-
bioRxiv - Immunology 2024Quote: ... and (2) the Human Cytokine 23-Plex Discovery Assay® (HD23; Millipore MILLIPLEX® Human Cytokine/Chemokine Magnetic Bead Panel II Immunology Multiplex Assay ...
-
bioRxiv - Immunology 2024Quote: ... 5 distinct shRNAs directed against CD2AP encoding human CMS (shCMS) (Sigma-Aldrich Mission TRCN shRNA Target set ...
-
bioRxiv - Synthetic Biology 2024Quote: ... or 96-well plates pretreated with 20 µg/mL human fibronectin (Millipore) for at least 10 min at 37°C.
-
bioRxiv - Synthetic Biology 2024Quote: ... or 24-well plates pretreated with 20 µg/mL human fibronectin (Millipore) for at least 10 min at 37°C ...
-
bioRxiv - Biochemistry 2024Quote: ... human full length NHE1 was cloned into p3xFLAG-CMV-14 (Sigma-Aldrich) containing a C-terminal 3xFLAG tag ...
-
bioRxiv - Neuroscience 2019Quote: ... recombinant ephrins or Fc were preclustered in a 5:1 molar ratio with either mouse or goat anti-human Fc (Millipore Sigma cat. no. 16760 and 12136 respectively) for 30’ at 37°C.
-
bioRxiv - Cell Biology 2020Quote: A2780 human ovarian cancer cells were maintained in RPMI-1640 medium (Sigma-Aldrich) supplemented with 10% (v/v ...
-
bioRxiv - Developmental Biology 2021Quote: ... mouse anti-human α-smooth muscle actin (Cy3 conjugated, cat. #C6198, Sigma Aldrich, 1:500 ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were then suspended in veronal buffer and human serum (Sigma-Aldrich, H4522) (or heat-inactivated for 30min at 56°C) ...
-
bioRxiv - Biochemistry 2020Quote: ... Recombinant proteases were obtained from the following vendors: human cathepsin L (Millipore Sigma, Athens Research and Technology ...
-
bioRxiv - Molecular Biology 2021Quote: The gene of human GAPDH was cloned into pET-28a(+) expression vector (Novagen) with an N-terminal His-tag followed by the Tobacco Etch Virus (TEV ...
-
bioRxiv - Biochemistry 2022Quote: ... or −3 human cDNA into a p3XFLAG-CMV-14 expression vector (Sigma, E7908). Then 3XFLAG-PRLs were cloned into pLenti-CMV-puro (Addgene 17452 ...
-
bioRxiv - Cell Biology 2022Quote: ... dried and incubated with 10 μg/mL of IgG from human serum (Sigma) in PBS for 1 hour at RT ...
-
bioRxiv - Neuroscience 2021Quote: ... were injected with 400 IU human chorionic gonadotropin (hCG; Sigma-Aldrich CG10; RRID:SCR_018232).
-
bioRxiv - Molecular Biology 2021Quote: ... bleomycin and human activating FAS (anti-FAS) antibody were purchased from Millipore Sigma. PGE2 ...
-
bioRxiv - Immunology 2022Quote: ... media was replenished with RPMI containing 5% type AB human serum (Sigma-Aldrich). For single-round experiments with VSV-G-pseudotyped viruses ...
-
bioRxiv - Systems Biology 2019Quote: ... The human plasma reference standard NIST SRM 1950 was obtained from Sigma Aldrich. Human cancer cells (HeLa S3 ...
-
bioRxiv - Cell Biology 2020Quote: ... in acetic acid (0.02 N) or human plasma fibronectin (5 µg/mL; Millipore) in PBS overnight at 4°C and rinsed with imaging medium to remove the coating solution ...
-
bioRxiv - Cancer Biology 2019Quote: ... Cells were blocked with human IgG (1.25 mg/mL, 15 min; Sigma Aldrich). Surface staining of unfixed/unpermeabilized cells employed the following antibodies ...
-
bioRxiv - Cell Biology 2019Quote: ... PINK1 knockdown was performed using MISSION® esiRNA human PINK1 (EHU057101, Sigma Aldrich). Mff knockdown (SI Fig ...
-
bioRxiv - Immunology 2019Quote: ... anti-human C5aR or nonpeptide C5aR antagonist W-54011 (5 μM, Merck Millipore)(25 ...
-
bioRxiv - Cell Biology 2019Quote: ... Staining for murine and human MSCs was performed using Oil Red O (Sigma) stain for adipogenesis ...
-
bioRxiv - Cell Biology 2020Quote: The human ovarian cancer cell lines COV318 (purchased from ECACC, via Sigma-Aldrich) and SKOV3 (courtesy of Dr Florence Delie ...
-
bioRxiv - Cancer Biology 2019Quote: ... human breast cancer were detached using Trypsin (when grown as monolayer, Sigma-Aldrich) or pelleted and dissociated using StemPro Accutase (when grown as spheres ...
-
bioRxiv - Immunology 2021Quote: ... Total IgA purified from human serum was used as a standard (Sigma-Aldrich). To generate the IgA standard curve anti-human IgA capture antibodies ...