Labshake search
Citations for Millipore Sigma :
2301 - 2350 of 10000+ citations for 6 PHENYL 1 3 DIHYDRO INDOL 2 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... an overlay (1:1 of 2% methylcellulose [Sigma] and culture media) is added to each well and incubation commenced for 3 days at 37 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 4X stock was mixed 1:1 with 2% sarkosyl (Sigma) to yield 2X complete run-on mix ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse Tubulin (clone B-5-1-2 from Sigma, 1:5000), rabbit ZW10 (ab21582 from abcam ...
-
bioRxiv - Developmental Biology 2022Quote: ... Activated (Diphosphorylated ERK-1&2) pERK 1:100 (M8159, Millipore Sigma). Samples were then washed three times with PBST and incubated with the corresponding AlexaFluo secondary antibodies (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... and 1 mg mL-1 of 2-nitrophenyl-β-galactopyranoside (Sigma)) ...
-
bioRxiv - Genomics 2023Quote: ... mouse α-tubulin (1:10,000, B-5-1-2, Sigma Aldrich). Secondary HRP-conjugated antibodies (Sigma Aldrich ...
-
bioRxiv - Molecular Biology 2020Quote: ... Up to 180mL of blood was collected into 3 60 mL syringes pre-loaded with 6 mL of anticoagulant acid citrate dextrose (ACD) (Sigma C3821 Lot#SLBW6172). Within 15 min of collection ...
-
bioRxiv - Plant Biology 2021Quote: ... medium, containing 3% sucrose, 10−6 M potassium indole acetate (Nacalai Tesque, Kyoto, Japan) and 10−5 M kinetin (Sigma, St. Louis, MO) at 25 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... 3 μM-sections were deparaffinized and antigen retrieval was performed in 10 mM citrate buffer (pH = 6; Sigma-Aldrich, St Louis, MO, USA) for 10 min ...
-
bioRxiv - Immunology 2022Quote: ... a known volume of trolox standard concentration would result in a similar reduction of the radical 2,2’-azino-bis-3-ethylbenzothiazoline-6-sulfonic acid (Sigma-Aldrich, St. Louis, MO). Samples were analyzed in triplicate ...
-
bioRxiv - Zoology 2022Quote: The frogs underwent double euthanasia according to institutional ethics guidelines under ethics approval number NWU-00380-16-A5-01: first anaesthesia in 6% ethyl-3-aminobenzoate methansulfonate (MS222) (Sigma-Aldrich Co., USA) and then euthanasia through pithing.
-
bioRxiv - Plant Biology 2023Quote: ... 1.5-ml glass vials (Ø×H 11.6 × 32 mm) containing ∼ 100 mg glass wool were filled with 200 µl (Z)-3-hexenyl acetate (HAC, >98%, Sigma-Aldrich, Buchs, Switzerland) and sealed with screw caps containing a rubber septum ...
-
bioRxiv - Cancer Biology 2023Quote: ... were deparaffinized and then subjected to antigen retrieval for 10 minutes at 121 uC at 15 PSI in 2.94 g/L sodium citrate (pH 6; Sigma Aldrich, 61332-04-3). Sections were permeabilized in PBS with 0.4% Triton X-100 (PBT ...
-
bioRxiv - Pathology 2020Quote: Ela-Cre AT-1fl/+ and Ela-Cre AT-1fl/fl mice at 2-3 months of age were treated with tamoxifen (MP Biomedicals, 3mg/40g BW dissolved in 98% corn oil [Sigma] and 2% ethanol [Sigma]) by oral gavage once daily for three days to induce Cre recombinase activity ...
-
bioRxiv - Microbiology 2019Quote: ... A 200 μL aliquot of a solution containing 100 μg/μL of XTT (2, 3-(2-methoxy-4-nitro-5-sulfophenyl)-5-[(phenylamino) carbonyl]-2H-tetrazolium hydroxide) (Sigma-Aldrich, St Louis, MO, USA) and 10 μg/μL of PMS (phenazine methosulfate ...
-
bioRxiv - Neuroscience 2022Quote: Mice were deeply anesthetized with 1 mL (overdose) of Avertin (2, 2, 2-Tribromoethanol; Sigma Aldrich, 20 mg/mL) and perfused intracardially with 12 mL of iced PBS ...
-
bioRxiv - Biophysics 2021Quote: ... The cantilevers were functionalized with amine groups by immersing in 2% (vol/vol) 3-aminopropyltriethoxysilane (Millipore Sigma) solution dissolved in acetone ...
-
bioRxiv - Microbiology 2019Quote: Primers used in this study (Table 2) were designed with Primer 3 (http://bioinfo.ut.ee/primer3-0.4.0/) and synthesized by Sigma-Aldrich.
-
bioRxiv - Cell Biology 2019Quote: Cell viability was assessed with 3-[4,5-Dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide (MTT, #M5655, Sigma Aldrich) after treatment with MMC and the PARP inhibitor Olaparib (AZD2281 ...
-
bioRxiv - Bioengineering 2021Quote: ... was added to the PEG solution followed by the addition of 1-[bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-oxide hexafluorophosphate] (HATU; 2.43 g, 6.4 mmol, 2 eq.; Sigma-Aldrich). Next ...
-
bioRxiv - Immunology 2022Quote: ... 2- or 3-days post fertilisation (dpf) zebrafish were anaesthetised in 0.168 mg/ml Tricaine (Sigma-Aldrich) in E3 media and visualised under a dissecting microscope ...
-
bioRxiv - Biochemistry 2021Quote: ... cell viability was determined using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma-Aldrich, MO) as described previously.52 Equivalent MTT assays were performed on cells cultured in the same ratios of PBS to media ...
-
bioRxiv - Immunology 2021Quote: ... or 25 µM (L-3-trans-(Propylcarbamyl) oxirane-2-carbonyl)-L-isoleucyl-L-proline (CA-074me) (Sigma) to inhibit cathepsin B ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... and thus 3-[2-(diethylamino)ethyl]-7-hydroxy-4-methylcoumarin (AHMC; Cat. No. 188611, Sigma-Aldrich Corp.) was used instead as previously described for the fluorescence quantification (Donato et al ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3 mg total protein were mixed with 2 mL Urea Buffer (UB) (8 M urea (Sigma, U5128) in 0.1 M Tris/HCl pH 8.0 and 50mM ammonium bicarbonate) ...
-
bioRxiv - Cancer Biology 2020Quote: ... collected and lysed with NP-40 lysis buffer supplemented with phosphatase inhibitor cocktails 2 and 3 (Sigma) and protease inhibitor mix (Sigma) ...
-
bioRxiv - Microbiology 2019Quote: ... 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide was dissolved in Dulbecco’s PBS (-) (Sigma-Aldrich, India) (pH 7.4 ...
-
bioRxiv - Microbiology 2021Quote: ... Plates were incubated for 3 hours before addition of 30 μL of the bacterial growth reporter MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] (2.5 mg/mL) (Sigma) and Tween 80 (10% ...
-
bioRxiv - Biochemistry 2021Quote: ... phosphatase inhibitor cocktail 2 and phosphatase inhibitor cocktail 3 were purchased from Sigma-Aldrich (St. Louis, MO). All other chemicals including V8 protease were purchased from FUJIFILM Wako ...
-
bioRxiv - Neuroscience 2021Quote: ... A CRISPR-Cas9 crRNA (5’- GAGGCCAAGATGAGTACTGAGG-3’) targeting exon 2 of Blvra was synthesized by Sigma Aldrich. A single-stranded oligo homology template (5’-ATGGACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGATTACAAGGATGACG ATGACAAGATGAGCACGGAGGTGAGCTGCCCTCAGGGGCTGTAAGGGACACCTTTGCTG-3’ ...
-
bioRxiv - Cancer Biology 2021Quote: Polyacrylamide (PA) gels of varying stiffness (0.5, 2, and 5 kPa) were fabricated on 3-APTMS (Sigma) functionalized glass coverslips by combining 40% acrylamide and 2% bis-acrylamide in specific ratios as described previously [81] ...
-
bioRxiv - Cancer Biology 2021Quote: Cell proliferation was assessed by 3-(4,5-1,2methylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay (Merck Millipore). K562 cells (5,000/well ...
-
bioRxiv - Neuroscience 2022Quote: ... The 2 odors used were 3-Oct (Sigma-Aldrich Cat# 218405-250G; CAS Number: 589-98-0) and MCH (Sigma-Aldrich Cat# 66360-250G ...
-
bioRxiv - Neuroscience 2022Quote: ... and blocked for 2 hours with blocking buffer (3% donkey serum in 0.1 M PBS; Sigma-Aldrich). Primary antibodies (ChAT ...
-
bioRxiv - Neuroscience 2022Quote: ... Internal solutions also contained 3-5mg/mL (0.3%-0.5%) of biocytin (Sigma-Aldrich, CAS# 576-19-2) which was added the day of recording.
-
bioRxiv - Systems Biology 2022Quote: ... The virus was collected both 2 days and 3 days later and 0.45 μm syringe filters (Millipore) were used to eliminate cells ...
-
bioRxiv - Microbiology 2022Quote: ... the cells were washed 3 times in PBS before addition of 2% Triton X–100 (Sigma-Aldrich) PBS solution to lyse the cells for enumeration of the intracellular bacteria ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... phosphatase inhibitor cocktail 2 (P5726) and 3 (P0044) were purchased from Sigma-Aldrich (St. Louis, MO, USA), and Doxorubicin (Adriamycin ...
-
bioRxiv - Cell Biology 2024Quote: ... DLD1 cells were treated for 2 h with 0.5 mM 3-indoleacetic acid (Sigma, stock in ethanol). At the time points indicated ...
-
bioRxiv - Neuroscience 2024Quote: ... after 2-3 months of receiving HFD the mice were given 75 mg/kg STZ (Sigma-Aldrich) in 0.1M sodium citrate buffer ...
-
bioRxiv - Cancer Biology 2023Quote: ... After that cells were treated with 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma-.Aldrich) in a 1:10 ratio in a culture medium and incubated at 37 °C for 3 h ...
-
bioRxiv - Plant Biology 2023Quote: ... 3-week-old plant leaves were infiltrated with 50 μM 2’,7’-dichlorodihydrofluorescein diacetate (H2DCFDA) (Millipore-Sigma) in 50 mM phosphate buffer (pH 7.4 ...
-
bioRxiv - Plant Biology 2023Quote: ... 3-week-old plant leaves were infiltrated with 50 μM 2’,7’-dichlorodihydrofluorescein diacetate (H2DCFDA) (Millipore-Sigma) in 50 mM phosphate buffer (pH 7.4 ...
-
bioRxiv - Neuroscience 2023Quote: ... Patch pipettes (resistance 2-3 MΩ) were filled with an intracellular solution containing (mM): 110 CsMeSO3 (Sigma), 4.6 MgCl2 ...
-
bioRxiv - Cell Biology 2023Quote: Cell viability was determined by adding 0.5 mg/mL 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma) substrate to cells and subsequent incubation at 37 °C and 5% CO2 for 1–2 h ...
-
bioRxiv - Neuroscience 2023Quote: ... 3-dione (CNQX) and 50 mM D,L-2-amino-5-phosphonovaleric acid (APV) acquired from Sigma to suppress post-synaptic responses ...
-
bioRxiv - Genetics 2023Quote: ... we subjected the amplified PCR products to electrophoresis using gels consisting of 2-3% agarose (Sigma Aldrich) in 1 x Tris-acetate-EDTA (1 x TAE ...
-
bioRxiv - Cancer Biology 2024Quote: Glass coverslips of 20×20 µm are coated with silane (2% (3-Trimethoxysil) propyl-methacrylate (Sigma #M6514)) ...
-
bioRxiv - Cancer Biology 2024Quote: Cell viability was assessed using colorimetric MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay following by the manufacturer’s instructions (Sigma). Briefly ...
-
bioRxiv - Bioengineering 2021Quote: ... 3 methylcholanthrene (3-MC; Sigma-Aldrich), contained in DMEM with a final concentration of 0.1% of dimethylsulfoxide (DMSO ...