Labshake search
Citations for Millipore Sigma :
2251 - 2300 of 3014 citations for 6 Chlorohexanenitrile since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... U2OS cells were seeded in a 6-well plate and infected with lentivirus supernatant in the presence of 5 μg/mL polybrene (Sigma). Medium was replaced by fresh media with 10 μg/mL Blasticidin S at 24 hours post-infection ...
-
bioRxiv - Molecular Biology 2019Quote: ... Cells were washed three times with 1x PBS and incubated for 5 minutes in 300 nM 4′,6-diamidino-2-phenylindole (Sigma) before a final 1x PBS wash ...
-
bioRxiv - Cell Biology 2019Quote: Undifferentiated SGBS cells were plated at 50 % confluence in 6-well plates and infected with commercial lentiviral particles targeting either human ABCG1 (TRCN0000420907; Sigma) (TAGGAAGATGTAGGCAGATTG ...
-
bioRxiv - Molecular Biology 2019Quote: ... All RNAs were then selectively modified with 10mM 1-methyl-6-nitroisatoic anhydride (1M6) (Sigma-Aldrich cat no. S888079-250MG) for 5 minutes at 37°C ...
-
bioRxiv - Developmental Biology 2019Quote: ... Sections were further incubated for 10 min at room temperature with DAPI (4’,6-diamidino-2-phenylindole, 1:5000, Sigma). Incubation with the secondary antibodies lasted for 3h at room temperature ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and MCA-Lys-Pro-Leu-Gly-Leu-Dpa(DNP)-Ala-Arg-NH2 (MMP substrate FS-6) was from Sigma-Aldrich. The stock solutions of the enzyme inhibitors and fluorogenic substrates were prepared according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... and resuspended in 50 to 80 µl FC buffer containing 0.1 µg/ml 4’,6-diamidino-2-phenylindole (DAPI; Sigma-Aldrich). Primary tumor samples were stained with CD45-APC-Cy7 (Biolegend ...
-
bioRxiv - Developmental Biology 2019Quote: ... Dechorionated live embryos were incubated for 6, 12 and 24 hours in 40μM Nifedipine or 20mM BDM (2, 3-butanedione-2-monoxime) (Sigma-Aldrich) in Danieau’s solution ...
-
bioRxiv - Microbiology 2020Quote: ... and the resulting adhered bacteria on the cover slip were stained with 200 μL of the membrane stain N-(3-Triethylammoniumpropyl)-4-(6-(4-(Diethylamino) Phenyl) Hexatrienyl) Pyridinium Dibromide (FM4-64) (Sigma) at a final concentration of 20 μg/mL for 5 minutes ...
-
bioRxiv - Developmental Biology 2020Quote: ... Next the slides were mounted with a coverslip using Mowiol (6 g glycerol, 2.4 gr polyvinylalcohol 4-88 (Sigma, 81381), 6 ml MQ and 12 ml 0.2 M Tris HCL pH 8.5).
-
bioRxiv - Developmental Biology 2021Quote: ... Slides were air dried for 6 hours to overnight with a post-fixation step of 15 minutes in 10% neutral buffered formalin (HT501128, Sigma) and washed in 1X PBS ...
-
bioRxiv - Developmental Biology 2021Quote: ... Slides were air dried for 6 hours to overnight with a post-fixation step of 15 minutes in 10% neutral buffered formalin (HT501128, Sigma) and washed in 1X PBS ...
-
bioRxiv - Neuroscience 2020Quote: ... To identify the total number of cells the nuclei were stained with DAPI (4’, 6-Diamino-2-phenylindole dihydrochloride) (1:10000, Millipore-Sigma). Images were acquired using Olympus BX61 microscope and analyzed using Fiji software (ImageJ).
-
bioRxiv - Microbiology 2021Quote: ... Labeled lentivirus particles were then purified to eliminate excess free dyes and lipids by ultracentrifugation for one hour at 40,000 rpm over a 6%-18% Optiprep (Sigma Aldrich) gradient ...
-
bioRxiv - Synthetic Biology 2020Quote: ... glass coverslips placed in 6-well plates were coated in a 0.1 mg/mL solution of poly-L-lysine hydrobromide (Sigma #P6282) for 5 min and left to dry overnight before plating 6×105 cells per well in 2 mL DMEM ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Cells were transiently transfected with plasmids in 6-well plates and 24 hours post-starvation were incubated with 100μg/ml of cycloheximide (Sigma #4859) for indicated time points ...
-
bioRxiv - Immunology 2019Quote: PBMCs (freshly isolated and previously frozen) and fresh whole blood were each stimulated for either 2 or 6 h with (1) PMA/ionomycin (Sigma) (PBMC ...
-
bioRxiv - Microbiology 2020Quote: ... the cells were fixed with 3% PFA/PBS and the nuclei stained with 4’,6-diamidine-2’-phenylindole (DAPI, Sigma). An inverted fluorescence microscope (Zeiss ...
-
bioRxiv - Pathology 2021Quote: ... rats in the high-dose 7-d L-DOPA priming group (n=6) were treated daily with L-DOPA (12 mg/kg) + benserazide (15 mg/kg, s.c., Sigma-Aldrich) for 7 d (i.e. ...
-
bioRxiv - Cell Biology 2019Quote: ... and plasma (n=6) of the experimental groups were filtered with a 30 kDa cut-off Microcon filter (Merck Millipore, Tullagreen Carrigtwohill Co.Cork ...
-
bioRxiv - Cancer Biology 2019Quote: ... Tissues were washed 5 times in PBT and incubated for 2h at RT with secondary antibodies and 4’,6-Diamidine-2′-phenylindole dihydrochloride (DAPI, Sigma) (1µg/mL) ...
-
bioRxiv - Developmental Biology 2020Quote: ... An incubation was done 45 min at room temperature with a mix of 4′,6-Diamidine-2′-phenylindole dihydrochloride (DAPI, 1µg/mL, 10236276001, Sigma-Aldrich) and the secondary antibody Donkey anti-Mouse Alexa Fluor 555 in PBS 1X ...
-
bioRxiv - Biophysics 2019Quote: ... as a Tobacco Etch Virus (TEV)-cleavable N-terminal His-tagged (6×-His) fusion protein using a pET46 Ek/LIC vector (Novagen) and purified using Ni-NTA affinity chromatography and gel filtration chromatography as previously described (Hughes et al ...
-
bioRxiv - Physiology 2020Quote: ... and probed overnight (4 °C) with one of the following primary antibodies: Anti-TSG-6 mouse monoclonal (1 μg/ml; Millipore); rat monoclonal TNFα (1 μg/ml ...
-
bioRxiv - Molecular Biology 2019Quote: ... was fused with an N-terminal His(6)-tag followed by maltose binding protein (MBP) tag and TEV cleavage site in pET21 vector (Novagen).
-
bioRxiv - Cancer Biology 2019Quote: ... RIPK3 inhibitor GSK 872 (N-(6-(Isopropylsulfonyl)quinolin-4-yl)benzo[d]thiazol-5-amine) was purchased from Millipore Sigma and frozen stocks were maintained in DMSO ...
-
bioRxiv - Cell Biology 2019Quote: ... then stained in 1x PBS + .5M NaCl with 50 ng/mL 4’,6-diamidino-2-phenylindole (DAPI) (Sigma-Aldrich #D9542).
-
bioRxiv - Neuroscience 2019Quote: hNSG and non-engrafted NSG mice (4-6 months old) were injected 3 mg/kg (i.p.) with lipopolysaccharide (LPS from E. coli; O55:B5, Sigma-Aldrich) or 0.9% saline solution ...
-
bioRxiv - Bioengineering 2021Quote: ... at −20°C for 6 minutes followed by a 1-hour incubation in blocking buffer containing 10 wt% BSA (Sigma) in PBS as previously described7 ...
-
bioRxiv - Developmental Biology 2020Quote: ... The pregnant mice were serially scanned at E6.5 either after intra-peritoneal administration of 1µg/g BW of hyaluronan synthesis inhibitor 6-diazo-5-oxo-1-norleucine (DON, Sigma-Aldrich) at E3.5-E5.5 ...
-
bioRxiv - Cell Biology 2020Quote: ... fixed accessory glands were permeabilised for 6 x 10 min in PBST (1 X PBS, 0.3% Triton X-100 [Sigma-Aldrich]), blocked for 30 min in PBSTG (PBST ...
-
bioRxiv - Cell Biology 2019Quote: ... The resin was resuspended in 6 ml ice-cold G-buffer containing 5 µg/ml TLCK-treated chymotrypsin (Sigma, #C3142) and incubated overnight at 4°C ...
-
bioRxiv - Physiology 2020Quote: ... rubens (< 6 cm diameter) were fixed by immersion in seawater Bouin’s fluid [75% saturated picric acid (Sigma-Aldrich, Gillingham, UK) in seawater ...
-
bioRxiv - Microbiology 2021Quote: ... in 6 well plates were transfected with HSIV-vif plasmids using Fugene 6 or X-tremeGENE 9 DNA transfection reagent (Roche/Sigma). At 48 hour post-transfection ...
-
bioRxiv - Cell Biology 2021Quote: ... and mouse monoclonal anti-Na+/K+ ATPase (1:500; SantaCruz) and anti-acetylated tubulin (1:2,000; clone 6-11B-1, Sigma Aldrich). Goat anti-mouse or rabbit IgG conjugated with HRP were used for secondary antibodies (1:10,000 ...
-
bioRxiv - Physiology 2021Quote: ... 6 × 105 cells were seeded on 6-well multiwell plates and counted every two days from day 4 to day 14 using Trypan blue (Sigma) and a Neubauer chamber.
-
bioRxiv - Immunology 2020Quote: ... Cells were washed once with PBS prior incubation for 5 min at 37 °C with 4′,6-diamidino-2-phenylindole (DAPI; Sigma). Finally ...
-
bioRxiv - Cell Biology 2022Quote: ... two shRNA targeting exon 5 and exon 6 were synthesized along with a control shRNA targeting the luciferase gene as a 97-nt ultramer (Sigma) containing 22-mer reverted repeats ...
-
bioRxiv - Developmental Biology 2021Quote: ... inactivated with 10 µg/ml mitomycin C and seeded at 4 × 105 per 6 cm dish) in DMEM/F12/KSR medium (D-MEM/F12 (Sigma) supplemented with 20% KSR additive ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cells were washed with staining medium and re-suspended in 4’,6-diamidino-2-phenylindole (DAPI; 1 μg/ml; Sigma) to eliminate dead cells from sorts and analyses ...
-
bioRxiv - Cell Biology 2020Quote: Total protein from confluent passage 1 Sirt5−/− and WT chondrocytes cultured in 6 cm dishes were collected in RIPA buffer containing 20 mM nicotinamide (Sigma) and protease inhibitors cocktail (ThermoFisher) ...
-
bioRxiv - Cell Biology 2020Quote: ... electroporated parasites were mixed immediately with 100 μl of reticulocyte-rich blood from a naïve mouse treated with phenylhydrazine (6 mg/ml) (Sigma-Aldrich), incubated at 37°C for 20 min and then injected intraperitoneally into another mouse ...
-
bioRxiv - Cell Biology 2021Quote: ... or control non-target shRNAs were induced to differentiate for 6 days and RNA was extracted with Tri-Reagent (Sigma) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... 3 µg of RNA were separated on MEN-buffered 1.5% agarose gels that provided denaturing conditions by 6% formaldehyde using an RNA sample loading buffer containing a final concentration of 62.5% (v/v) deionized formamide (Sigma-Aldrich). Afterwards ...
-
bioRxiv - Microbiology 2021Quote: ... The enzyme reaction was started by the addition of 0.16 ml of 6 mM p- nitrophenyl β-D-glucuronide (Sigma) to the broken cells and stopped by the addition of 0.4 ml of 1.0 M NaCO3 ...
-
bioRxiv - Immunology 2020Quote: ... Cells were then treated with 6-thio-dG (3-5 μM) in the presence of 500 ng/ml doxycycline (Sigma), washed three times with warm PBS and allowed to recover in regular growth medium containing 500 ng/ml doxycycline ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were then analyzed on a Guava EasyCyte 6/2L bench cytometer equipped with 488 nm and 532 nm lasers (Millipore).
-
bioRxiv - Microbiology 2020Quote: ... Cells were then fixed with 1% formaldehyde solution and analyzed using a Guava EasyCyte 6/2L bench cytometer equipped with 488 nm and 532 nm lasers (Millipore).
-
bioRxiv - Immunology 2021Quote: ... were characterized and fractionated by size exclusion chromatography using a Superose 6 10/300 GL on an AKTA liquid chromatography system and concentrated on AmiconUltra 100k spin columns (Millipore).
-
bioRxiv - Microbiology 2021Quote: ... before cells were fixed with 1% formalin for 30 minutes and stained using Giemsa stain (SIGMA-ALDRICH®, 6% diluted) for 1 hour ...