Labshake search
Citations for Millipore Sigma :
2201 - 2250 of 10000+ citations for 6 METHOXY 1 2 3 4 TETRAHYDRO NAPHTHALENE 2 CARBALDEHYDE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2022Quote: ... Cultures were treated with the indicated amount of 1-(1,1-dimethylethyl)-3-(1-naphthalenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-amine (1-NM-PP1; Millipore Sigma), taken from a 10,000x stock in DMSO ...
-
bioRxiv - Microbiology 2020Quote: ... HB10Y samples were titered prior to freezing by serially diluting samples in 10 millimolar (mM) of 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES, Sigma PN#H4034-100G) + 10% Sucrose (Sigma PN #S7903-250G) ...
-
bioRxiv - Developmental Biology 2021Quote: ... for 2 -4 hours at RT with the following antibodies at the following concentrations: rabbit Cone Arrestin (1:3000, Millipore Sigma, cat. #AB15282), chicken B-galactosidase (1:3000 ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were incubated in PBS containing 0.02% Triton X-100 and 2% NDS overnight at 4°C with primary antibodies: anti-ChAT (1:500, goat polyclonal, Millipore Cat# AB144P, RRID:AB_2079751) and anti-phosphorylated ribosomal protein S6 (p-rpS6240/244 ...
-
bioRxiv - Cell Biology 2021Quote: ... pH 7.4, 100 mM NaCl, 10% glycerol, 1% Triton X-100, 2 mM EDTA, Roche complete protease inhibitor set, and Sigma phosphatase inhibitor set), incubated on ice for 30 min ...
-
bioRxiv - Cancer Biology 2019Quote: ... and finally with the refractive index matching solution BABB-D4 containing 4 parts BABB (benzyl alcohol + benzyl benzoate 1:2, Sigma, 24122 and W213802), 1 part diphenyl ether (DPE ...
-
bioRxiv - Molecular Biology 2019Quote: ... JQ1 was delivered every other day via intraperitoneal injection at a concentration of 50mg/kg in a 1:4 DMSO:10% (2-Hydroxypropyl)-β-cyclodextrin (Sigma Aldrich; 389145) vehicle starting the day of TAC surgery ...
-
bioRxiv - Microbiology 2019Quote: ... without L-glutamine and without phenol red (Biochrom, Berlin, Germany) supplemented with 30 mM HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid) (Sigma-Aldrich, Taufkirchen, Germany), pH 7.4 ...
-
bioRxiv - Microbiology 2022Quote: ... HB10Y samples were titered prior to freezing by serially diluting samples in 10 millimolar (mM) of 4-(2-hydroxyethyl)-1- piperazineethanesulfonic acid (HEPES, Sigma PN#H4034-100G) + 10% Sucrose (Sigma PN #S7903-250G) ...
-
bioRxiv - Neuroscience 2023Quote: ... Sections were then incubated with secondary antibodies at 4°C for 2 days in CF™ 633 Anti-Rabbit IgG H+L 1:1000 (Sigma-Aldrich; SAB4600132), Alexa Fluor® 488 AffiniPure Donkey Anti-Goat IgG H+L 1:800 (Jackson ImmunoResearch ...
-
bioRxiv - Cell Biology 2023Quote: Cells were arrested in prometaphase by incubating them for 2 – 4 h in 200 ng ml-1 nocodazole (Sigma-Aldrich, 31430-18-9). Mitotic exit was induced by adding flavopiridol (Tocris Bioscience ...
-
bioRxiv - Plant Biology 2023Quote: ... The endocarp was submerged in 1:4:5 v/v/v mixture of 30% hydrogen peroxide (HX0635-2; EMD Millipore, Burlington, MA, USA), distilled water ...
-
bioRxiv - Cell Biology 2020Quote: ... 400,000 cells were plated in 6-well poly (2-hydroxyethyl methacrylate) (poly-HEMA, Sigma-Aldrich, St. Louis, MO, USA)-coated plates for the indicated amount of time in the figure legends ...
-
bioRxiv - Immunology 2019Quote: ... spleens from C57BL/6 mice were cut to smaller pieces and digested with Collagenase D (2 mg/ml, Sigma) For 30 min at 37°C ...
-
bioRxiv - Developmental Biology 2020Quote: ... mice were fasted for 6 hours prior to IP injection of 2 g/kg 20% D-glucose (Sigma-Aldrich) in water with a 26G needle ...
-
bioRxiv - Developmental Biology 2022Quote: ... cells were then spun down (2 min with 1000 rpm) and resuspended in 6 ml serum-free medium (Sigma Cat# ...
-
bioRxiv - Cancer Biology 2020Quote: ... at an age of 6-10 weeks by a single intra peritoneal injection of 2 mg Tamoxifen (Sigma; T5648) in corn oil (Sigma ...
-
bioRxiv - Cell Biology 2024Quote: ... 561 and 640 nm laser lines were used for excitation of DAPI (4rn,6-Diamidino-2-phenylindole, Sigma-Aldrich), Alexa Fluor 555 and Alexa Fluor 647 respectively ...
-
bioRxiv - Neuroscience 2024Quote: Adult female flies aged 2–6 days post eclosion were head-fixed to a custom mount using eicosane (Sigma). Cuticle ...
-
bioRxiv - Plant Biology 2021Quote: ... Five days after germination the plant were incubated in liquid in ½ MS with 1% sucrose media with or without 50 µM 2-bromopalmitate (2-BrP; Sigma-Aldrich), and with or without 100 mM NaCl ...
-
bioRxiv - Microbiology 2020Quote: ... were then transferred to 2 mL microtubes containing 1 mL of lysis buffer [2% (m/v) cetyltrimethyl ammonium bromide (Sigma Aldrich), 1.4 M NaCl ...
-
bioRxiv - Immunology 2020Quote: PBMC or Expanded T cell lines were stimulated for 5h at 37°C with or without SARS-CoV-1/2 peptide pools (2 μg/ml) in the presence of 10 μg/ml brefeldin A (Sigma-Aldrich). Cells were stained with the yellow LIVE/DEAD fixable dead cell stain kit (Invitrogen ...
-
bioRxiv - Immunology 2022Quote: ... Strains were streaked from frozen stock onto yeast extract peptone dextrose (YPD; 1% yeast extract, 2% peptone, 2% dextrose, Sigma-Aldrich) agar and left overnight at 37°C ...
-
bioRxiv - Microbiology 2022Quote: ADCP assays were performed using ExpiCHO-S cells transiently transfected with SARS-CoV-2 spike glycoproteins (Wuhan D614, BA.1, or BA.2) and labelled with PKH67 (Sigma Aldrich) as targets ...
-
bioRxiv - Plant Biology 2022Quote: ... 0.85 % saline (2 mins), Phosphate Buffered Saline (PBS) (2 mins), 0.125 mg ml-1 Pronase (37°C, 10 mins) (Sigma-Aldrich, P2308), 0.2 % Glycine (2 mins ...
-
bioRxiv - Cell Biology 2022Quote: ... #T9284)/PBS (15 minutes), washed in 1× PBS, and incubated (2 hours) with blocking solution (2% BSA, 5% donkey serum (SIGMA, #D9663), and 0.3% Triton X-100/PBS) ...
-
bioRxiv - Immunology 2024Quote: ... adhered cells were incubated for 2 h at 37°C with 100 µL of 1% p-nitrophenylphosphate (2 mg/mL, Sigma-Aldrich) in AMP buffer (0.1 M ...
-
bioRxiv - Bioengineering 2023Quote: ... Cells were washed with PBST and then incubated for 2 h at room temperature in PBS with 2 μg mL−1 DAPI (D9542, Sigma-Aldrich). Cells were imaged using an LSM980 confocal microscope (Zeiss) ...
-
bioRxiv - Cell Biology 2023Quote: ... on ice in LCMS-grade acetonitrile/methanol/water (2:2:1 v/v) with 1nmol scyllo-inositol internal standard per sample (Sigma Aldrich). Sample debris was then removed via centrifugation and polar metabolite extracts were dried using a SpeedVac Vacuum Concentrator ...
-
bioRxiv - Biophysics 2023Quote: Crude and low-dense MVs were exposed to SCL medium supplemented with CaCl2 (2 mM) and either 2 mM Na2HPO4 or 1 mM adenosine triphosphate (Sigma-Aldrich). Mineralization was carried out at 37°C and using samples with fixed 50 µg of total protein/mL concentration ...
-
bioRxiv - Biophysics 2021Quote: ... The cantilevers were functionalized with amine groups by immersing in 2% (vol/vol) 3-aminopropyltriethoxysilane (Millipore Sigma) solution dissolved in acetone ...
-
bioRxiv - Microbiology 2019Quote: Primers used in this study (Table 2) were designed with Primer 3 (http://bioinfo.ut.ee/primer3-0.4.0/) and synthesized by Sigma-Aldrich.
-
bioRxiv - Cell Biology 2019Quote: Cell viability was assessed with 3-[4,5-Dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide (MTT, #M5655, Sigma Aldrich) after treatment with MMC and the PARP inhibitor Olaparib (AZD2281 ...
-
bioRxiv - Bioengineering 2021Quote: ... was added to the PEG solution followed by the addition of 1-[bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-oxide hexafluorophosphate] (HATU; 2.43 g, 6.4 mmol, 2 eq.; Sigma-Aldrich). Next ...
-
bioRxiv - Immunology 2022Quote: ... 2- or 3-days post fertilisation (dpf) zebrafish were anaesthetised in 0.168 mg/ml Tricaine (Sigma-Aldrich) in E3 media and visualised under a dissecting microscope ...
-
bioRxiv - Biochemistry 2021Quote: ... cell viability was determined using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma-Aldrich, MO) as described previously.52 Equivalent MTT assays were performed on cells cultured in the same ratios of PBS to media ...
-
bioRxiv - Immunology 2021Quote: ... or 25 µM (L-3-trans-(Propylcarbamyl) oxirane-2-carbonyl)-L-isoleucyl-L-proline (CA-074me) (Sigma) to inhibit cathepsin B ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3 mg total protein were mixed with 2 mL Urea Buffer (UB) (8 M urea (Sigma, U5128) in 0.1 M Tris/HCl pH 8.0 and 50mM ammonium bicarbonate) ...
-
bioRxiv - Cancer Biology 2020Quote: ... collected and lysed with NP-40 lysis buffer supplemented with phosphatase inhibitor cocktails 2 and 3 (Sigma) and protease inhibitor mix (Sigma) ...
-
bioRxiv - Microbiology 2019Quote: ... 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide was dissolved in Dulbecco’s PBS (-) (Sigma-Aldrich, India) (pH 7.4 ...
-
bioRxiv - Microbiology 2021Quote: ... Plates were incubated for 3 hours before addition of 30 μL of the bacterial growth reporter MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] (2.5 mg/mL) (Sigma) and Tween 80 (10% ...
-
bioRxiv - Biochemistry 2021Quote: ... phosphatase inhibitor cocktail 2 and phosphatase inhibitor cocktail 3 were purchased from Sigma-Aldrich (St. Louis, MO). All other chemicals including V8 protease were purchased from FUJIFILM Wako ...
-
bioRxiv - Neuroscience 2021Quote: ... A CRISPR-Cas9 crRNA (5’- GAGGCCAAGATGAGTACTGAGG-3’) targeting exon 2 of Blvra was synthesized by Sigma Aldrich. A single-stranded oligo homology template (5’-ATGGACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGATTACAAGGATGACG ATGACAAGATGAGCACGGAGGTGAGCTGCCCTCAGGGGCTGTAAGGGACACCTTTGCTG-3’ ...
-
bioRxiv - Cancer Biology 2021Quote: Polyacrylamide (PA) gels of varying stiffness (0.5, 2, and 5 kPa) were fabricated on 3-APTMS (Sigma) functionalized glass coverslips by combining 40% acrylamide and 2% bis-acrylamide in specific ratios as described previously [81] ...
-
bioRxiv - Cancer Biology 2021Quote: Cell proliferation was assessed by 3-(4,5-1,2methylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay (Merck Millipore). K562 cells (5,000/well ...
-
bioRxiv - Neuroscience 2022Quote: ... The 2 odors used were 3-Oct (Sigma-Aldrich Cat# 218405-250G; CAS Number: 589-98-0) and MCH (Sigma-Aldrich Cat# 66360-250G ...
-
bioRxiv - Neuroscience 2022Quote: ... and blocked for 2 hours with blocking buffer (3% donkey serum in 0.1 M PBS; Sigma-Aldrich). Primary antibodies (ChAT ...
-
bioRxiv - Neuroscience 2022Quote: ... Internal solutions also contained 3-5mg/mL (0.3%-0.5%) of biocytin (Sigma-Aldrich, CAS# 576-19-2) which was added the day of recording.
-
bioRxiv - Systems Biology 2022Quote: ... The virus was collected both 2 days and 3 days later and 0.45 μm syringe filters (Millipore) were used to eliminate cells ...
-
bioRxiv - Microbiology 2022Quote: ... the cells were washed 3 times in PBS before addition of 2% Triton X–100 (Sigma-Aldrich) PBS solution to lyse the cells for enumeration of the intracellular bacteria ...