Labshake search
Citations for Millipore Sigma :
2201 - 2250 of 10000+ citations for 5 Benzyloxy pyrimidine 2 carbonitrile since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... sections were rinsed in SSC 5 X for 5 min then washed in formamide 50% (Sigma)-SSC 2 X for 30 min at 60°C ...
-
bioRxiv - Cell Biology 2020Quote: ... washed with PBS for 5 min and blocked with 5% bovine serum albumin (BSA; Sigma-Aldrich) in PBS-Tween 20 (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2021Quote: ... antipapain and pepstatin A) supplemented with 5 mM MgCl2 and 5 KU Benzonase nuclease (Merck Millipore). After incubation at 4°C for 30 minutes to assure the complete lysis ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 mM ZnCl2 and 50 mM NaCl) and 5 mU phosphodiesterase II from Sigma (# P9041-10UN) were added and the mixture was incubated at 37°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... mice were intraperitoneally injected with 250 mg/kg 5-fluorocytosine (5-FC) (Sigma Aldrich, Cat: F71291G), and after 12 hours ...
-
bioRxiv - Immunology 2023Quote: ... 4 weeks after BM transplantation animals were injected with 5-FU (5-fluorouracil F6627, Sigma-Aldrich) at a dose of 150 mg/kg in 100ul of PBS ...
-
bioRxiv - Cancer Biology 2024Quote: ... Membranes were blocked with 5% BSA-TBST (5% BSA Sigma, TBS 1x Euromedex, 0,1% Tween20 Sigma) for 30 min and incubated with primary antibodies (diluted in 5% BSA-TBST ...
-
bioRxiv - Cancer Biology 2024Quote: ... Membranes were blocked with 5% BSA-TBST (5% BSA Sigma, TBS 1x Euromedex, 0,1% Tween20 Sigma) for 30 min and incubated with primary antibodies (diluted in 5% BSA-TBST ...
-
bioRxiv - Immunology 2024Quote: ... followed by 4 - 5 hours of stimulation by phorbol myristate acetate (PMA, 5 ng/ml, Sigma) and ionomycin (500 ng/ml ...
-
bioRxiv - Immunology 2024Quote: ... at 37⍰°C supplemented with 5 mM uridine and 5 mM uracil (u/u, both Sigma) for the A1160 ΔpyrG strain ...
-
bioRxiv - Synthetic Biology 2022Quote: Animals were acclimated for 5 days before streptomycin sulfate (5 mg ml-1; Sigma-Aldrich S9137) was added to the autoclaved drinking water to decrease the number of facultative aerobic/anaerobic resident bacteria69 ...
-
bioRxiv - Neuroscience 2022Quote: ... 5 µL of supernatant was separated on a SeqQuant Zic-pHILIC 5 um column (Millipore #150460). For each experiment ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 times and then blocked with 5% Bovine Serum Albumin (BSA; Sigma-Aldrich, St. Louis, MO) in PBS for 2 hours at 37°C ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... After blocking with 5% bovine serum albumin (Roth, Karlsruhe, Germany) or 5% skim milk (Sigma Aldrich) in TBS pH 7.4 plus 1% Tween-20 for 1 h (RT) ...
-
bioRxiv - Biochemistry 2024Quote: ... 5 mM TCEP and 5% glycerol pH 8.0) supplemented with ∼10 mg lysozyme (Millipore Sigma, L1667), 25 μl/ml BioLock biotin blocker (IBA ...
-
bioRxiv - Plant Biology 2024Quote: ... seeds were added with 5 µL Thiazolyl Blue Tetrazolium Bromide (MTT, 5 g/L, SIGMA-Aldrich) per well eight days-post treatment and kept at 21 °C in dark for one day ...
-
bioRxiv - Biochemistry 2024Quote: ... membrane was blocked with 5% non-fat milk in PBST or 5% BSA (Sigma-Aldrich, A9085) at RT for 1 hour ...
-
bioRxiv - Cell Biology 2024Quote: ... 5% fly serum and insulin (5 mg/ml) by pipetting using coated yellow tips (Sigmacote, Sigma).
-
bioRxiv - Neuroscience 2022Quote: ... was carbon filtered and passed through PFA vials (Savillex 200-30-12) containing odor (2% methyl valerate in mineral oil, Sigma Aldrich product #1489977; 2% 2-heptanone in mineral oil, Sigma Aldrich product # 537683 ...
-
iDePP: a genetically encoded system for the inducible depletion of PI(4,5)P2 in Arabidopsis thalianabioRxiv - Plant Biology 2020Quote: ... coli (Novagen and Supplementary file 5) were transformed with pMH-HS-Sumo-dOCRL168-509 vector (KanR ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5-diphenyl-tetrazolium bromide (Sigma-Aldrich) powder ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5□µg/ml human insulin (Sigma), 100 U/ml penicillin and 100□μg/ml streptomycin (Gibco ...
-
bioRxiv - Neuroscience 2021Quote: ... apo-transferrin (5 µg/ml, Sigma), superoxide-dismutase (0.8 µg/ml ...
-
bioRxiv - Biophysics 2020Quote: ... Blebbistatin 5 μM 1h (Sigma Aldrich), Latrunculin A 0.12 μM 2h45 (Sigma Aldrich) ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 μg/ml insulin (Sigma; I6634), 0.1 nM cholera toxin (Sigma ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 µM XAV939 (Sigma-Aldrich X3004); 10 µM SB203580 (Tocris 1402) ...
-
bioRxiv - Neuroscience 2021Quote: ... 5 μg/ml NAC (Sigma A8199), and 10 μM Hydrocortisone (Sigma H0888) ...
-
bioRxiv - Developmental Biology 2021Quote: ... CDDP (5 mg/kg) (Millipore Sigma) or CTX (150 mg/kg ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1:5 000 SLX4IP (Sigma, HPA046372), 1:5 000 FLAG (Sigma ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1:5 000 FLAG (Sigma, F1804), 1:10 000 AR (Santa Cruz ...
-
bioRxiv - Genetics 2020Quote: ... and Penicillin (5 U/ml, Sigma). All lines used in this study were certified to be free of mycoplasma by a qPCR [47] with a detection limit below 10 genomes/ml ...
-
bioRxiv - Microbiology 2020Quote: ... 5 g/L of NaCl (Sigma); 2.5 g/L of dipotassium hydrogen phosphate (Macron)] or TSB with 0.5% glucose (TSBg) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5% of 1,6-hexanediol (Sigma-Aldrich) was added after anti-IgM stimulation.
-
bioRxiv - Developmental Biology 2021Quote: ... and 5% Goat serum (Sigma, G9023). Samples were incubated with the primary antibody in blocking solution overnight at 4 °C ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5 mg ml−1 dispase (Sigma) and 1 mg ml−1 DNase (Sigma ...
-
bioRxiv - Developmental Biology 2020Quote: ... Following blocking in 5% Milk (Sigma) in TBST ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5 mg of tamoxifen (Sigma #T5648) were administered by gavage to pregnant females ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5 ug linear polyacrylamide (Sigma-Aldrich) was included as a neutral carrier for RNA precipitation ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5% dimethyl sulfoxide (DMSO; Sigma, D8418), 1% bovine serum albumin (BSA ...
-
bioRxiv - Cancer Biology 2022Quote: ... and Vinculin (VIN-11-5, Sigma). Primary antibodies were detected with HRP-conjugated anti-rabbit or anti-mouse IgG and visualised with Immobilon Western HRP substrate (Merck).
-
bioRxiv - Cancer Biology 2020Quote: ... 5 mM EDTA (E7899, Sigma-Aldrich), and 2.5% FBS (Gibco) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 mM Vanadyl ribonucleoside comples (Sigma), 0.5% Triton X-100 ...
-
bioRxiv - Developmental Biology 2022Quote: ... blocked with 5% BSA (Sigma-Aldrich) in 0.1% TritonX-100 at RT for 1 hr ...
-
Endothelial transmigration hotspots limit vascular leakage through heterogeneous expression of ICAM1bioRxiv - Immunology 2022Quote: ... 5 mM glucose (All Sigma-Aldrich), and 0.4% (w/v ...
-
bioRxiv - Genomics 2020Quote: ... 5 uM retinoic acid (Sigma, R2625) was added with LIF-deprived medium and auxin was also added continuously to the CTCF-depleted cell samples ...
-
bioRxiv - Biochemistry 2021Quote: ... control non-TRE: 5’CCTGCGTAGTTCCATAAGGATAGC (Sigma).
-
bioRxiv - Genomics 2020Quote: ... 5% Eosin Y (Sigma-Aldrich, USA) in 0.45M Tris acetate (Sigma-Aldrich ...
-
bioRxiv - Immunology 2021Quote: ... 5% heat-inactivated horse serum (Sigma), 2mM L-glutamine ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 μg/ml polybrene (Sigma-Aldrich) was added ...
-
bioRxiv - Biochemistry 2020Quote: ... Cytocholasin B (5 μM, Sigma-Aldrich) was used to determine non-specific glucose uptake ...