Labshake search
Citations for Millipore Sigma :
2201 - 2250 of 7624 citations for 3 Methoxy Acetaminophen d3 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2024Quote: ... 3) 30 seconds in Harris’ modified Haematoxylin solution (Sigma HHS16), 4 ...
-
bioRxiv - Developmental Biology 2024Quote: ... 100 µM 3-maleimidobenzoic acid N-hydroxysuccinimide ester (Sigma-Aldrich), 100 µM ethylene glycol bis(succinimidyl succinate ...
-
bioRxiv - Cell Biology 2024Quote: ... followed by coating with 3 mg/ml Concanavalin A (Sigma) for 1 hour at 37 °C ...
-
bioRxiv - Microbiology 2024Quote: ... 50mg 3-(Acrylamido) phenylboronic acid (Sigma Aldrich Cat No. 771465), 1ml 10X RNase-free TAE ...
-
bioRxiv - Cell Biology 2024Quote: ... the substrate was treated with (3-Aminopropyl) triethoxysilane (Sigma-Aldrich), diluted at 5% in absolute ethanol ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 3% bovine serum albumin (w/v) (Sigma, A-7888) at room temperature ...
-
bioRxiv - Developmental Biology 2024Quote: ... Samples were blocked with 3% donkey serum (Millipore Sigma, D9663) in PBS for 2 hours at room temperature and incubated overnight at 4°C using the following concentrations ...
-
bioRxiv - Cell Biology 2024Quote: ... 500 μL of 3 mg/mL Collagenase (Sigma-Aldrich, C6885) was added to the supernatant and the mixture was incubated at 37°C for 45 minutes under constant shaking ...
-
bioRxiv - Cell Biology 2024Quote: ... After blocking with a 3% goat serum (Sigma-Aldrich – S26) solution in PBS for 1 hour ...
-
bioRxiv - Biochemistry 2024Quote: ... using 3:1 polyethylenimine (average Mw, ∼25,000 Da; Sigma-Aldrich) to total DNA ratio (4 μg BRSK and 2 μg TAU DNA ...
-
bioRxiv - Immunology 2024Quote: ... and subsequently washed 3 times with PBS 2% FBS (Sigma). pDCs were enriched from freshly isolated PBMCs using the human Plasmacytoid Dendritic Cell Isolation Kit II (Miltenyi Biotec ...
-
bioRxiv - Bioengineering 2024Quote: ... a 2% 3-(Trimethoxysilyl)propyl methacrylate (TMSPMA, Sigma-Aldrich 440159) (v/v ...
-
bioRxiv - Neuroscience 2024Quote: ... diluted in blocking solution (3% Bovine serum albumin, Sigma-Aldrich, Burlington ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were then blocked with 3% BSA (Sigma-Aldritch #A9647) for 30 minutes before incubation with primary antibody for 30 minutes ...
-
bioRxiv - Microbiology 2024Quote: ... solution then permeabilized in 3% Bovine Serum Albumin (BSA) (Millipore), 1% Saponin (Calbiochem) ...
-
bioRxiv - Microbiology 2024Quote: ... and lysed with BugBuster Protein Extraction Reagent (Novagen, #70921-3). Recombinant mSLPI was purified with a Ni-NTA resin column as described by the manufacturer (Qiagen) ...
-
bioRxiv - Microbiology 2024Quote: ... and lysed using BugBuster Protein Extraction Reagent (Novagen, #70921-3). Protein concentration in the lysate was measured by absorbance at 280 nm using the nanodrop (Fisher Scientific) ...
-
bioRxiv - Cell Biology 2024Quote: ... and 0.5 mM 3-isobutyl-1-methylxanthine (IBMX, Sigma, #I5879). After two days ...
-
bioRxiv - Immunology 2024Quote: ... and 15 acid-washed 3-mm glass beads (Sigma-Aldrich). Total RNA was isolated from a volume of lung homogenate equivalent to 30 mg of tissue using the RNeasy Tissue Kit and RNase-Free DNase Set (both Qiagen ...
-
bioRxiv - Microbiology 2024Quote: ... filtering through a 3-μm Whatman Nucleopore filter (Millipore Sigma), centrifugation (2000xg ...
-
bioRxiv - Molecular Biology 2024Quote: ... Phase separation was achieved with 1-bromo-3-chloropropane (Sigma), and the resulting aqueous phase was precipitated in isopropanol ...
-
bioRxiv - Biophysics 2024Quote: ... 500 mM 3-(1-Pyridin)-1-Propansulfonat (NDSB-201; Sigma) for protein stabilisation ...
-
bioRxiv - Cancer Biology 2024Quote: ... and blocked (3% BSA (Bovine Serum Albumin, Sigma-Aldrich #A7030) and 0.1% Tween (Sigma-ldrich)) ...
-
bioRxiv - Cancer Biology 2024Quote: 3% poly-2-hydroxyethyl methacrylate (poly-HEMA; P3932, Sigma-Aldrich) solution was prepared in 95% absolute ethanol ...
-
bioRxiv - Cell Biology 2024Quote: ... 10 μM Nigericin (Sigma-Aldrich, N7143, CAS: 28643-80-3), 2.5 μM Saliphenylhalamide (Salip ...
-
bioRxiv - Neuroscience 2024Quote: D-4-amino-3-isoxazolidone (DCS, C3909 Sigma-Aldrich, UK) was prepared in sterile saline solution (6) ...
-
bioRxiv - Neuroscience 2024Quote: ... phosphatase inhibitor cocktail 2 and 3 purchased from Sigma Aldrich, MO ...
-
bioRxiv - Neuroscience 2024Quote: ... permeabilized for 30 min with 3% Triton-X (Millipore Sigma) in 1x PBS ...
-
bioRxiv - Bioengineering 2024Quote: ... and phase-separated in 1-bromo-3-chloropropane (B9673, Sigma) [82,95] ...
-
bioRxiv - Cancer Biology 2024Quote: ... followed by endogenous peroxidase inactivation with 3% H2O2 (Sigma-Aldrich) and subsequently blocked in 5% BSA in TBS-T with TBS washes inbetween each step ...
-
bioRxiv - Biochemistry 2024Quote: ... and 1 mM DTT supplemented with 3 mM ATP (Sigma) and 3 mM MgCl2 ...
-
bioRxiv - Immunology 2024Quote: ... reverse primer (5’-3’): GACGGTGCCATGGAATTTGC) and purchased from Sigma-Aldrich. RT-qPCR was performed with gene-targeted primers using TB Green Premix Ex Taq II (Tli RNase H Plus ...
-
bioRxiv - Immunology 2024Quote: ... 0.3% Triton X-100 and 3% Bovine Serum Albumin (Sigma). Cells were stained with antibodies for 30m-1h at room temperature or up to overnight at 4°C ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... and IBMX (3-Isobutyl-methylxanthine, 25µM, Sigma-Aldrich, Toluca Mexico) with ACSF was perfused for 25min ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3 mM MgCl2) containing 250 U/ml Benzonase (Sigma, E1014), 1X cOmplete EDTA-free protease inhibitor cocktail (Roche ...
-
bioRxiv - Neuroscience 2024Quote: ... the plates were thawed and 3 mM acetyl-CoA (Sigma), 1 mM DTNB (Sigma) ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 mM 3-indol-acetic acid (IAA; Sigma-Aldrich, I2886) was added 1 h prior to adding phleomycin or β-estradiol.
-
bioRxiv - Cell Biology 2024Quote: ... 500 µM 3-Isobutyl-1-methylxanthine (IBMX, Sigma-Aldrich #I5879), and 1 µM dexamethasone (Gbiosciences ...
-
bioRxiv - Neuroscience 2024Quote: ... The odorants 3-octanol (>95% purity; Fluka 74878, Sigma-Aldrich) and 4- methylcyclohexanol (99% purity ...
-
bioRxiv - Genomics 2024Quote: ... Membranes were blocked in 3 % w/ v BSA (Sigma-Aldrich) in TBST and then incubated with primary antibodies overnight at 4 °C ...
-
bioRxiv - Cancer Biology 2024Quote: ... cells were exposed to 3-Methyladenine (5 mM; Sigma, M9281) for 24 hours ...
-
bioRxiv - Bioengineering 2024Quote: ... 10 mM Magnesium Chloride (MgCl2) (7786-30-3, Sigma Aldrich), 2 mM dithiothreitol (DTT ...
-
bioRxiv - Biophysics 2024Quote: ... either 1.1 µm or 3 µm polystyrene beads (Sigma Aldrich) were used when using either MyOne or M270 Dynabeads (Thermo Fisher ...
-
bioRxiv - Biophysics 2024Quote: ... 500 µM 3-Isobutyl-1-methylxanthine (IBMX, Sigma-Aldrich #I5879), and 1 µM dexamethasone (Gbiosciences ...
-
bioRxiv - Cell Biology 2024Quote: ... Neurons were blocked in 3% normal goat serum (Millipore Sigma) and 0.3% Triton X-100 diluted in PBS at RT for 1 hr ...
-
bioRxiv - Bioengineering 2024Quote: ... and 3-(Trimethoxysily)propyl methacrylate were obtained from Sigma Aldrich.
-
bioRxiv - Bioengineering 2024Quote: ... the membranes were treated with (3-Aminopropyl)triethoxysilane (Millipore-Sigma) at 5% (v/v in isopropyl alcohol ...
-
bioRxiv - Bioengineering 2024Quote: ... the membranes were treated with (3-Aminopropyl)triethoxysilane (Millipore-Sigma) at 5% (v/v in isopropyl alcohol ...
-
bioRxiv - Cancer Biology 2024Quote: ... Endogenous peroxidases were quenched with 3% H2O2 (Sigma Aldrich, H1009), blocked with Avidin (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2024Quote: ... for 24h or 3% DSS (Sigma-Aldrich, cat no. 42867) for 48h applied on a glass microfiber filter (Whatman) ...