Labshake search
Citations for Millipore Sigma :
2151 - 2200 of 10000+ citations for Suppressor of CDC2 With RNA Binding Motif 2 RBMS1 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was extracted using the GenElute Mammalian Total RNA Miniprep Kit (Sigma-Aldrich) followed by polyA+ mRNA isolation using Dynabeads Oligo(dT)25 (Thermo Fisher ...
-
bioRxiv - Developmental Biology 2022Quote: RNA isolation was performed using a GenElute™ mammalian total RNA miniprep kit (Sigma) according to the manufacturers protocol ...
-
bioRxiv - Plant Biology 2019Quote: ... Total RNA was extracted using a Spectrum Plant Total RNA kit (Sigma–Aldrich, USA), and DNase I was added and purified using an RNA Clean & Concentrator kit (Zymoresearch ...
-
bioRxiv - Plant Biology 2020Quote: RNA was isolated from leaves using the Spectrum Plant Total RNA Kit (Sigma-Aldrich) following the manufacturer’s recommendations ...
-
bioRxiv - Developmental Biology 2020Quote: Total RNA was isolated using the GenElute Mammalian Total RNA Kit (Sigma, Madrid, Spain). A total of 300 ng from each RNA extraction was treated with DNAse (Promega ...
-
bioRxiv - Genetics 2022Quote: ... RNA was isolated as described in the Spectrum Total Plant RNA Kit (Sigma Aldrich) manual ...
-
bioRxiv - Plant Biology 2022Quote: ... Total RNA was extracted using the SpectrumTM Plant Total RNA Kit (Sigma, STRN-250) using Protocol A (750 μL Binding Solution ...
-
bioRxiv - Genomics 2022Quote: ... RNA was subsequently extracted using the Spectrum Plant Total RNA kit from Sigma-Aldrich, and purified cDNAs were sequenced on PacBio’s Sequel II instrument.
-
bioRxiv - Evolutionary Biology 2022Quote: ... Bulk RNA was isolated using the GenElute™ Mammalian Total RNA Miniprep kit (Sigma). Illumina HiSeq1 Libraries were prepared for Illumina HiSeq 51bp paired-end sequencing and sequenced on the NovaSeq 6000 (Duke Center for Genomics and Computational Biology ...
-
bioRxiv - Plant Biology 2022Quote: Total RNA was extracted from seedlings using the Spectrum Plant Total RNA kit (Sigma). M-MLV reverse transcriptase (Fermentas ...
-
bioRxiv - Plant Biology 2021Quote: ... Total RNA was isolated using the Spectrum™ Plant Total RNA Kit (Sigma-Aldrich), according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: Leaf RNA extractions were performed using the Spectrum Plant Total RNA Kit (Sigma-Aldrich). RNA extractions from developing inflorescences were performed using the RNeasy Plant Mini Kit (Qiagen) ...
-
bioRxiv - Microbiology 2021Quote: ... [33] and total RNA was extracted using Spectrum Plant Total RNA Kit (Sigma-Aldrich). DNase treatment was performed with the RNase-Free DNase set (Qiagen ...
-
bioRxiv - Plant Biology 2019Quote: RNA extraction was performed using the Spectrum™ Plant Total RNA kit (Sigma-Aldrich), followed by DNase I treatment (amplification grade DNase I ...
-
bioRxiv - Physiology 2020Quote: ... Total RNA was purified using the GenEluteTM mammalian total RNA miniprep kit (Sigma-Aldrich) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... Total RNA was extracted using the Spectrum™ Plant Total RNA Kit (Sigma-Aldrich) following the manufacturer’s recommended protocol ...
-
bioRxiv - Immunology 2020Quote: RNA was isolated from cells using the GenElute Mammalian Total RNA kit (Sigma Aldrich) according to the manufacturer’s protocol (for more than 4×106 cells ...
-
bioRxiv - Molecular Biology 2022Quote: ... Total RNA was extracted using a commercial RNA isolation kit (Sigma Aldrich, Deisenhofen, Germany), and reversely transcribed into cDNA from 1 μg of mRNA template using the M-MuLV cDNA Synthesis Kit (New England Biolabs ...
-
bioRxiv - Plant Biology 2022Quote: ... RNA was isolated using the Spectrum Plant Total RNA kit (Sigma-Aldrich, Stockholm, Sweden) according to the manufacturer’s instructions except for an additional sonication step as described by Nguyen et al ...
-
bioRxiv - Plant Biology 2024Quote: ... We extracted total RNA from the samples using Spectrum Plant Total RNA kit (Sigma). RNA samples were treated with DNase I during RNA extraction ...
-
bioRxiv - Cancer Biology 2024Quote: ... Total RNA was purified using GenElute Single Cell RNA Purification Kit (Sigma-Aldrich RNB300), treated with DNase I on column (Sigma-DNASE70-1SET) ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNA was isolated using GenElute™ Mammalian Total RNA Miniprep Kit (Sigma-Aldrich) from approximately 5 million cells per biological sample of PDA530Met cells ...
-
bioRxiv - Developmental Biology 2023Quote: Total RNA was extracted from cells using GeneElute Mammalian Total RNA MiniPrep Kit (Sigma), including on-column Dnase treatment to remove any contaminating DNA ...
-
bioRxiv - Plant Biology 2023Quote: The total RNA was extracted using Spectrum™ Plant Total RNA kit (Sigma-Aldrich) as per the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: Total RNA was extracted according to the Sigma RNA Extraction Kit (#RTN350-1KT, Sigma) protocol ...
-
bioRxiv - Plant Biology 2024Quote: ... Total RNA was extracted with the Spectrum Plant Total RNA kit (Sigma-Aldrich, USA) according to the manufacturer’s manual ...
-
bioRxiv - Genetics 2024Quote: ... and then incubated with primary antibodies (HIF-1α antibody, Cell Signaling 36169; TSPO antibody, ThermoFisher MA5-24844; Histone-H3 antibody, Millipore Sigma 05-499) diluted in the blocking buffer overnight at 4 °C ...
-
bioRxiv - Physiology 2022Quote: ... 2-bromopalmitate (2-BP) was delivered with fatty acid-free bovine serum albumin (Sigma-Aldrich, A6003) at a stock concentration 1 mM albumin with 5 mM 2-BP ...
-
bioRxiv - Cell Biology 2019Quote: ... the cell pellet was resuspended in 2 ml of 2 mg/ml collagenase IA (Sigma Aldrich) in PBS and incubated for 1 h at 37 °C on a horizontal shaker at 100 rpm ...
-
bioRxiv - Physiology 2019Quote: ... Bis-2-(5-phenylacetamido-1,3,4-thiadiazol-2-yl)ethyl sulfide (BPTES, Sigma Aldrich Cat. No# SML0601) was used at a concentration of 20μM for 1 hour in low (5 mM ...
-
bioRxiv - Biochemistry 2020Quote: ... 2-acetazolamide and 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) were purchased from Millipore-Sigma ...
-
bioRxiv - Plant Biology 2020Quote: ... 2 mM EDTA and 1 % [v/v] protein phosphatase inhibitor cocktail 2 and 3 (Sigma-Aldrich)) were added at a concentration of 2 mL/g tissue powder ...
-
bioRxiv - Immunology 2021Quote: ... Materials for interference testing included 2-phenoxyethanol (2-PE) (77699-250ML, Sigma-Aldrich, St Louis, MO), sodium citrate tribasic dihydroxide (C8532-100G ...
-
bioRxiv - Systems Biology 2021Quote: ... 2 pmol (2 µL of stock) of the non-labelled AQUA® peptide HLEAAKGYSFTTTAEKAAELHK (Sigma-Aldrich) containing the quantification tag sequence GYSFTTTAEK was added to enable quantification of SIL-protein stock concentrations using MS analysis based on the ratio of heavy-to-light GYSFTTTAEK signals (see below) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Bacterial Glycerol Stock Sequence (same as Construct 2) 2# CCGGGCTGTTACTTTCCCAGATATTCTCGAGAATATCTGGGAAAGTAACAGCTTTTTG) constructs were purchased from Sigma Aldrich. The plasmids were packaged into Lentiviral particles using the 2rd generation packaging plasmid (Addgene) ...
-
bioRxiv - Neuroscience 2022Quote: ... we injected approximately 2 μL of DNA (2 μg/μL) mixed with 0.1% Fast Green (Sigma) in PBS into a lateral ventricle of the embryonic brain with a pulled glass micropipette ...
-
bioRxiv - Plant Biology 2019Quote: ... resuspended in 2 ml of BY-2 medium supplemented with 150 µM acetosyringone (D134406, Sigma-Aldrich) and incubated at 28°C ...
-
bioRxiv - Neuroscience 2020Quote: ... were performed with MTT (3-(4, 5-dimethylthiazol-2-yl)-2-5-diphenyltetrazolium bromide) (Sigma-Aldrich) as described in Sanz et al ...
-
bioRxiv - Cancer Biology 2019Quote: ... 5-chloro-2′-deoxyuridine (CldU) and 5-Iodo-2′-deoxyuridine (IdU) were obtained from Sigma-Aldrich. Click-iT EdU Alexa Fluor 488 Imaging Kit was obtained from Invitrogen ...
-
bioRxiv - Biophysics 2019Quote: HUVECs were purchased from Lonza and cultured in Endothelial Cell Basal Medium (EBM-2) supplemented with 2% fetal calf serum (Sigma) and the following growth factors ...
-
bioRxiv - Bioengineering 2019Quote: ... HDI crosslinker (#52649) and 2-(trifluoromethyl)phenyl isocyanate (2-TPI) (#159379) were purchased from Sigma Aldrich. N,N-dimethylformamide (DMF ...
-
bioRxiv - Cancer Biology 2021Quote: ... at 2 dpf in egg water with 0.003% 1-Phenyl-2-thiourea (PTU; Sigma, Cat#P7629) to suppress pigmentation ...
-
bioRxiv - Molecular Biology 2021Quote: ... Protein sample (400 μg) was reduced by adding 2 μl of Tris(2-carboxyethyl)phosphine (Sigma) and incubating samples at 60 °C for 1 h ...
-
bioRxiv - Neuroscience 2022Quote: ... mice were deeply anesthetized with avertin (2,2,2-tribromoethaol 1.25%, 2-methyl-2-butanol 0.78%; 20 µL/g, i.p.; Sigma Aldrich) and transcardially perfused with PBS followed by 4% paraformaldehyde in PBS ...
-
bioRxiv - Neuroscience 2022Quote: ... The retinas were dissected and embedded in 2% low melting agar (2-hydroxymethyl agarose, Sigma Aldrich), mounted on a vibratome (DSK Microslicer ...
-
bioRxiv - Cancer Biology 2024Quote: ... pH 2 buffer with 25% w/v (2-hydroxypropyl)-β-cyclodextrin (HP-β-CD, Sigma-Aldrich). Treatments were aliquoted into single and combined daily doses and frozen at -80 ºC ...
-
bioRxiv - Developmental Biology 2024Quote: ... which was prepared as a 100% (w/v) stock solution in 2-methyl-2-butanol (Sigma), diluted 1:40 in PBS ...
-
bioRxiv - Neuroscience 2024Quote: ... Slices were incubated for 2 hours at room temperature with 2% normal donkey serum (Sigma, G6767) in PBS overnight at 4 °C with c-Fos primary antibodies (226003 ...
-
bioRxiv - Microbiology 2024Quote: ... 2-hydroxyibuprofen (2-OH-IBU) and carboxyibuprofen (CBX-IBU) were obtained from Sigma-Aldrich (Steinheim, Germany). All chemicals and solvents used were of the highest purity available.
-
bioRxiv - Biochemistry 2023Quote: 2-Pyridinecarboxaldehyde (1) and 6-(1-piperazinylmethyl)-2-pyridinecarboxaldehyde bistosylate salt were purchased from Sigma-Aldrich. 5-Ethynylpicolinaldehyde (“alkyne-2PCA” ...