Labshake search
Citations for Millipore Sigma :
2151 - 2200 of 4285 citations for Human NID1 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: Human Huh7 cells treated with either DMSO or CHIR99021 (3 µM; Sigma) for 48h were seeded (20,000 cells per well in 100µL ...
-
bioRxiv - Neuroscience 2024Quote: Human neurons were differentiated from ReNcell VM neuronal precursor cells (EMD Millipore) as described earlier [7] ...
-
bioRxiv - Synthetic Biology 2024Quote: ... mice were injected intraperitoneally with 8 mg of human transferrin (Sigma Aldrich) to promote bacterial growth in vivo ...
-
bioRxiv - Cancer Biology 2024Quote: ... obtained from the human CRISPR Library (Sigma-Aldrich, St Louis, MO, USA). Transduced cells were selected with puromycin ...
-
bioRxiv - Physiology 2024Quote: ... HBECs were seeded directly onto human placental collagen (HPC, Sigma-Aldrich, C8374)-coated permeable supports (Costar Transwells ...
-
bioRxiv - Microbiology 2024Quote: ... were coated with 1/20,000 dilution of Goat anti-Human Fab (Sigma) overnight at 4°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1:100 penicillin/streptomycin and 10% male human AB serum (Sigma-Aldrich) (“T-cell medium”) ...
-
bioRxiv - Cancer Biology 2024Quote: ... derived from the cortical region of human fetal brain tissue (Millipore, #SCC007) were cultured as previously described74 ...
-
bioRxiv - Bioengineering 2024Quote: ... the human IgG was purchased from Sigma (Sigma Aldrich, St Louis, MO). Then the IR800 dye was dissolved in DMSO (10mg/ml) ...
-
bioRxiv - Bioengineering 2024Quote: ... or horseradish peroxidase-conjugated goat anti-human IgG Fc antibody (Sigma, A0170) diluted 1:20,000 in the blocking buffer for an hour at 37°C ...
-
bioRxiv - Cell Biology 2020Quote: ... The lentivirus plasmid vector pLKO 1-YFP was obtained from Sigma’s validated genome-wide TRC shRNA libraries (Sigma-Aldrich ...
-
bioRxiv - Genetics 2021Quote: ... Plasmids were then transformed into Rosetta II cells (Sigma -71402-4) and grown on agar plates with 100mg/ml ampicillin overnight at 37°C.
-
bioRxiv - Microbiology 2020Quote: ... This fragment was cloned into pET24a(+) plasmid NdeI-XhoI digested (Novagen) to generate pET24-Ssr0692 plasmid ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Plasmids encoding the selected populations were extracted using Lyticase (Sigma # L2524). The eUNG gene (636bp ...
-
bioRxiv - Neuroscience 2021Quote: ... and 1μL of 2μg/μL plasmid with 0.1% Fast Green (Sigma) was injected by hand into the lateral ventricle using a Picospritzer II (Parker) ...
-
bioRxiv - Microbiology 2019Quote: ... digested with NdeI and BamHI and inserted into plasmid pET11b (Novagen). For expression of His-tagged proteins (GapDH ...
-
bioRxiv - Synthetic Biology 2020Quote: ... coli cultures using Sigma GenElute™ Plasmid Miniprep kit (Sigma-Aldrich).
-
bioRxiv - Biochemistry 2019Quote: ... plasmids were transformed into BL21-Rosetta 2 (DE3)-competent cells (Millipore). The E ...
-
bioRxiv - Biochemistry 2019Quote: ... and ligated into digested pET28a(+) plasmid (#69864-3, Novagen, Merck Biosciences). QIAquick® PCR Purification Kits (QIAGEN ...
-
bioRxiv - Immunology 2021Quote: ... the kanamycin (km) resistance cassette was amplified from plasmid pET26b (Novagen) using primers k1 and k2 ...
-
bioRxiv - Bioengineering 2020Quote: ... and assembled into the pCDF-1b plasmid (ColDF13 ori, Millipore, US) replacing the MCS region by Gibson Assembly ...
-
bioRxiv - Cancer Biology 2020Quote: ... pETDuet-Twist-E47 plasmids were transformed into Rosetta2(DE3)-pLysS (Millipore) bacteria ...
-
bioRxiv - Cell Biology 2021Quote: ... The plasmids were transformed into Rosetta2 (DE3) competent cells (Novagen, 71397). The recombinant proteins were purified using SBP-tag and StrepTactin Sepharose ...
-
bioRxiv - Microbiology 2019Quote: ... and cloned into a pSF-CAG-KAN plasmid (Sigma-Aldrich, Merck). These were co-transfected into DF-1 cells with Lipofectamine™ 2000 and the supernatant containing virus was passaged onto additional DF-1 cells to generate viral stocks ...
-
bioRxiv - Biophysics 2021Quote: ... and isolated using the GenElute Plasmid Miniprep kit (Sigma, Cat# PLN350). In addition ...
-
bioRxiv - Cell Biology 2022Quote: ... the plasmids were transfected with the FuGENE HD Transfection Reagent (Sigma). After transfection ...
-
bioRxiv - Biochemistry 2022Quote: ... all expression plasmids were transformed into BL21DE3 codon plus cells (Novagen) and protein expression induced by addition of 0.1mM isopropyl-β-D-thiogalactoside and overnight shaking at 16°C ...
-
bioRxiv - Biochemistry 2022Quote: ... retromer plasmids were transformed into BL21(DE3) Rosetta2 pLysS cells (Millipore). Cells were grown to an OD600 between 0.8-1.0 and induced for 16-20 hours at 22°C with 0.4 mM IPTG ...
-
bioRxiv - Biochemistry 2021Quote: ... The expression plasmids pET15b and pMAL-c2X were obtained from Novagen and New England Biolabs ...
-
bioRxiv - Biochemistry 2022Quote: ... the appropriate plasmids were transformed into Rosetta2(DE3)pLysS cells (Novagen) and transformants on Luria Broth (LB ...
-
bioRxiv - Systems Biology 2020Quote: ... We amplified attB-TurboGFP off of the SHC003 plasmid (Sigma SHC003).
-
bioRxiv - Synthetic Biology 2019Quote: ... Plasmid pET-Himar-dCas9 was electroporated into competent Rosetta2 cells (Novagen); transformants were selected on chlor (34 ug/mL ...
-
bioRxiv - Molecular Biology 2019Quote: ... The plasmid DNA was transformed into Rosetta2 DE3 cells (Novagen Inc.) and overexpressed in 4 L of Terrific Broth media by supplementing 2% (v/v ...
-
bioRxiv - Microbiology 2019Quote: ... Gene expression from the plasmid was induced by adding rhamnose (Sigma) to a final concentration of 0.2% (w/v) ...
-
bioRxiv - Microbiology 2021Quote: ... coli was done using the GenElute Plasmid Miniprep Kit (Sigma-Aldrich) or the Monarch Plasmid Miniprep Kit (New England Biolabs).
-
bioRxiv - Biochemistry 2020Quote: ... The plasmid was transformed into Rosetta 2(DE3)pLysS cells (Novagen).
-
bioRxiv - Cell Biology 2019Quote: ... retromer plasmids were transformed into BL21(DE3) Rosetta2 pLysS cells (Millipore). Cells were grown to OD600 between 0.8-1.0 and induced for 16-20 hours at 22°C with 0.4 mM IPTG ...
-
bioRxiv - Biochemistry 2020Quote: ... by PCR and inserted into bacterial expression plasmid pET23a (Novagen, USA) in order to construct either pET-hGFAT2 with and without HisTag ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... We purified the vector with the GeneEluteTM Plasmid Miniprep kit (Sigma), and prepared the injection mix at 300 ng/μl vector concentration diluted with injection buffer (5 mM KCl ...
-
bioRxiv - Immunology 2021Quote: ... NK92 cells were transduced with lentivirus vector pLKO-(Plasmid TRCN0000039984; Sigma), pLKO.1-puro eGFP shRNA control (Plasmid SHC005 ...
-
bioRxiv - Genetics 2020Quote: The plasmids were transformed into BL21(DE3) RIL cells (Novagen Inc). When the cell density reached an optical density at 600 nm (OD600 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... the CRISPR-lenti lentiviral vector Non-directed control plasmid (Sigma-Aldrich) was used ...
-
bioRxiv - Immunology 2023Quote: ... and 5 ng of pEF-Slc46 expression plasmid using GeneJuice (Millipore) for 24 h ...
-
bioRxiv - Biophysics 2022Quote: The expression plasmid was transformed into Rosetta 2 (DE3) cells (Novagen). 20 mL LB with 38 μg/mL chloramphenicol and 100 μg/mL carbenicillin was inoculated with a single Rosetta 2 (DE3 ...
-
bioRxiv - Microbiology 2023Quote: ... Plasmid DNA was prepared using the Midi-Prep kit (Sigma-Aldrich) and preparations were analyzed after digestion with endonucleases by electrophoresis in 0.8% agarose gel in TAE buffer (40 mM Tris-HCl ...
-
bioRxiv - Biochemistry 2023Quote: Lysozyme gene was amplified from the pLysS plasmid (Millipore Sigma-Novagen) with the oligonucleotide primers Fw-lys-NdeI (CCCATATGGCTCGTGTACAGTTTAAACAACGTG ...
-
bioRxiv - Biochemistry 2023Quote: Lysozyme gene was amplified from the pLysS plasmid (Millipore Sigma-Novagen) with the oligonucleotide primers Fw-lys-NdeI (CCCATATGGCTCGTGTACAGTTTAAACAACGTG ...
-
bioRxiv - Systems Biology 2023Quote: The NSP10-NSP16 co-expression plasmid (cloned into pETDuet-1, Novagen) was transformed into E ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Plasmid backbones were amplified from the commercially available pCOLADuet (EMD Millipore) expression vector via PCR followed by digestion with the restriction enzyme DpnI ...
-
bioRxiv - Microbiology 2023Quote: ... and other plasmid construction are located in Table S2 (Sigma Aldrich). Bacterial strains and plasmids used or generated in this study are described in Table S1.