Labshake search
Citations for Millipore Sigma :
2151 - 2200 of 10000+ citations for HLA A*0201 WT 1 complex Protein Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... CUT&RUN was performed in WT and CTCF-site edited Patski cells using antibodies for CTCF (Millipore 07-729), H3K27ac (Abcam ab4729 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cut&Run for H3K27me3 was performed on clone Tsix-Kdm6aΔE/ΔE17 and wt cells using an antibody against H3K27me3 (Millipore) following a published protocol [59] ...
-
bioRxiv - Bioengineering 2023Quote: ... as well as wt-modified and mtrA+-modified electrodes soaked for 15 min in 50 μM DCMU (Sigma-Aldrich). At least three different biological triplicates were taken for each sample ...
-
bioRxiv - Immunology 2023Quote: ... HEK293T cells constitutively expressing VHH-EGFP fusions were seeded in Ibidi chambers (9·104 cells per well) coated with poly-L-lysine (mol wt 70,000-150,000) (Sigma Aldrich). They were transiently transfected with 0.25 µg of the expression vectors GSDMD I104N-mCherry or GSDMDNT I104N-mCherry ...
-
bioRxiv - Cell Biology 2023Quote: ... 15 μg of GST-INCENP wt or S61E were incubated with the indicated amounts of CDK1-CyclinB1 (Sigma #SRP5009) in 50 μL reactions in kinase buffer (50 mM Tris– HCl pH 7.5 ...
-
bioRxiv - Cell Biology 2023Quote: SLI-WT parasites were allowed to settle onto 12 mm coverslips pre-treated with 10% Poly-L-Lysine (Sigma) in Milli-Q water ...
-
bioRxiv - Biophysics 2023Quote: A solution was prepared by dissolving 2 wt% of agarose (specifically, ultra-low gelling temperature agarose from Sigma Aldrich) in 10 ml of distilled water ...
-
bioRxiv - Bioengineering 2024Quote: ... we used injections of 5 wt% methyl cellulose (MC) (Methocel A15C, [MW = 304 kDa; 27.5–31.5% substitution], Sigma #64625) hydrogels loaded with BDA as a control group in these studies.
-
bioRxiv - Microbiology 2024Quote: Nasal swab storage medium (100 μL) was inoculated onto BHI agar supplemented with 0.1% Tween-80 +/- 0.005% wt/vol lithium mupirocin (Sigma-Aldrich). Oral swab storage medium (100 μL ...
-
bioRxiv - Cell Biology 2024Quote: Islet MTs were incubated sequentially in 3D InSight Krebs Ringer HEPES Buffer (KRHB; InSphero AG, Switzerland) with 0.5% wt/vol bovine serum albumin (Sigma) with low (2.8 mmol/l ...
-
bioRxiv - Cell Biology 2019Quote: ... Protein samples were diluted to 1 M urea with 50 mM TEAB buffer and digested with 1:100 trypsin (Sigma) 2 h at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... Precleared lysates containing the differently tagged or untagged proteins were mixed in a 1/1 ratio and incubated with anti-FLAG-agarose beads (Sigma) overnight at 4°C to precipitate the FLAG-tagged proteins ...
-
bioRxiv - Molecular Biology 2020Quote: ... and expression of the protein was induced for 4 hours with 1 mM isopropyl 1-thio-B-D-galactopyranoside (Sigma) at 18°C ...
-
bioRxiv - Neuroscience 2020Quote: ... sections were incubated overnight at room temperature with an antibody against mHTT protein (1-82 aa, Millipore, MAB5492 1:500), and either NeuN (Millipore ...
-
bioRxiv - Cell Biology 2021Quote: ... 1 mg of extracted protein was transferred to Eppendorf tubes to incubate with anti-FLAG-antibody (1:1000; Millipore Sigma) or anti-HIS-antibody (1:300 ...
-
bioRxiv - Genetics 2021Quote: ... glial fibrillary acidic protein (GFAP; polyclonal 1:1000, ZO334, DAKO-Agilent, Santa Clara, CA, USA; monoclonal 1:1000, MAB 3402, Millipore, Burlington ...
-
bioRxiv - Neuroscience 2021Quote: ... the cells were incubated with the primary antibodies of interested proteins at 4°C overnight (Nestin, 1:1000, Sigma; Tuj1, 1:1000, Sigma; GFAP ...
-
bioRxiv - Neuroscience 2022Quote: ... using rabbit antisera to the microglial protein Iba1 (1:1000; Fujifilm Wako Pure Chemical Corp) and AlexaFluor Donkey anti-rabbit 594 (1:1000; Millipore). Slides were cover slipped with Vectashield containing DAPI (Vector laboratories).
-
bioRxiv - Molecular Biology 2024Quote: ... the membrane was incubated with primary antibodies against protein of interest (NPR, Santa Cruz, sc-39008, 1:100; GFP, Aveslab, GFP-1020, 1:5,000; FLAG, Sigma, F1804 ...
-
bioRxiv - Immunology 2020Quote: ... plasma samples were incubated at a dilution of 1:100 and bound antibodies were detected with goat anti-human IgM/HRP (Sigma: cat. A6907, 1:6’000 dilution), goat anti-human IgG/HRP (Thermo Fisher ...
-
bioRxiv - Cancer Biology 2022Quote: ... Media were collected from HEK293 cells 48 hours after transfection and used for transductions in a final concentration of 8 ug/mL polybrene (Sigma-Aldrich, cat. TR-1003). Selection and maintenance of transduced cells was achieved with 5 ug/mL puromycin (Gibco ...
-
bioRxiv - Biophysics 2023Quote: ... and human embryonic kidney 293 (HEK293) cells were obtained from the American Type Culture Collection (ATCC; Manassas, VA, USA) and maintained in DMEM (D5796, Sigma-Aldrich, St. Louis, MO), which was supplemented with 10% FBS (12676029 ...
-
bioRxiv - Cell Biology 2023Quote: ... to validate the gene expression the plasmid (vide-supra) was transfected into HEK293 cells using PEI (Sigma-Aldrich/Merck Cat. No. 49553-93-7) following an optimized version of the standard protocol(Rajendra ...
-
Shear stress and very low levels of ligand synergize to activate ALK1 signaling in endothelial cellsbioRxiv - Cell Biology 2023Quote: ... tccagagaagcctaaagtgat) or non-targeted control (shCont, Cat: SHC002) were generated in HEK293 cells using the Sigma Mission system (Sigma-Aldrich, St. Louis, MO USA). HUVECs were seeded into a 6-well dish at a density of 80,000 cells per well ...
-
bioRxiv - Plant Biology 2021Quote: ... and subjected to a one-step immuno-affinity reaction using the rabbit peroxidase-anti-peroxidase soluble complex antibody (Sigma-Aldrich, St. Louis, USA). The membrane was developed ...
-
bioRxiv - Microbiology 2022Quote: ... The GCN4-M87/LL-37 complex was concentrated by ultrafiltration using a 3,500 MWCO membrane (Millipore; 4,500 x g, 30 min, 15 °C) to 8 mg/ml ...
-
bioRxiv - Microbiology 2021Quote: Fusion-GEM complexes (10 μg per mouse) were mixed with a complex adjuvant of ISA 201 VG (Seppic, Paris, France) and poly(I:C) (Sigma, St. Louis, MN, USA). Each milliliter of vaccine contained 350 μl of fusion-GEM complexes ...
-
bioRxiv - Cancer Biology 2022Quote: ... and an equal amount of the preparation was used to estimate the mitochondrial complex I activity as per the manufacturer’s protocol (Sigma, MAK359, lot no. 6E01K09680). The readings were measured at an optical density of 600nm using a microplate reader set at RT ...
-
bioRxiv - Neuroscience 2022Quote: ... sections were incubated in biotinylated anti-rabbit secondary antibody 1:500 (Vectors Laboratories, #BA-1000) followed by Avidin/Biotin complex amplification (Vectastain Elite ABC kit; Vectors Laboratories, #PK-6100) and DAB (Sigma Life Science, #5905) mixed with 3% hydrogen peroxide for signal amplification ...
-
bioRxiv - Bioengineering 2023Quote: ... the formation of the HA-Alcian blue complex was reversed by adding 8M guanidine hydrochloride (dissolved in deionized water) (Sigma-Aldrich, Schnelldorf, Germany). The dissolved Alcian blue ...
-
bioRxiv - Biophysics 2021Quote: ... Micropatterned coverslips were functionalized with a solution of 10 µg mL-1 FN from human plasma (Sigma Aldrich #F1056) for 1 h at room temperature ...
-
bioRxiv - Cancer Biology 2021Quote: ... solutions of 89Zr-labeled TDM1 (4 μCi/μg) were prepared in PBS (pH 7.5) containing 1% w/v human serum albumin (HSA, Sigma) and 0.1% w/v sodium azide (NaN3 ...
-
bioRxiv - Developmental Biology 2021Quote: ... 1×105 ESCs were plated on a 3.8 cm2 plate coated with human plasma fibronectin (Millipore, cat. no. FC010) and cultured in N2B27 medium supplemented with 12 ng/ml bFGF (R&D Systems ...
-
bioRxiv - Cancer Biology 2019Quote: The AsPC-1 and Capan-2 human PC cell lines were obtained from Sigma-Aldrich (St. Louis, MO, USA) and Thermo Fisher (Waltham ...
-
bioRxiv - Neuroscience 2019Quote: ... the eye cup was treated for ∼ 15 minutes with human plasmin (∼ 50 µg mL−1, Sigma or Haematologic Technologies) to aid vitreous removal.
-
bioRxiv - Bioengineering 2020Quote: ... Three sections at varying depths within the tumor are immunostained with mouse anti-human nuclei (clone 235-1, Millipore) followed by secondary Dylight 488 horse anti-mouse (Vector) ...
-
bioRxiv - Microbiology 2021Quote: ... THP-1 (ATCC® TIB-202™) human monocyte cell line was cultured in RPMI-1640 medium (Sigma, R8758) supplemented with 10% FBS ...
-
bioRxiv - Biophysics 2021Quote: The human esaHis-tagged PTPN11 (residues 1-528) cDNA was cloned in a pET-26b vector (Novagen, MA, USA). Nucleotide substitutions associated with NS or leukemia were introduced by site-directed mutagenesis (QuikChange site-directed mutagenesis kit ...
-
bioRxiv - Neuroscience 2020Quote: ... Plates were washed with PBST and incubated with a goat anti-human Fc−peroxidase antibody diluted 1:5,000 (Sigma) in blocking buffer for 30 min ...
-
bioRxiv - Neuroscience 2020Quote: ... The plates were then washed and incubated with a 1:5,000 dilution of peroxidase-conjugated anti-human Fc antibody (Sigma) for 1 hr ...
-
bioRxiv - Neuroscience 2022Quote: ... 50% Neurobasal Medium, 0.5% N2 supplement, 1% B27 without vitamin A [Life Technologies, 12587-010], 0.025% [v/v] human insulin [Sigma, I9278] ...
-
bioRxiv - Cancer Biology 2022Quote: ... human tumor slides were stained by immunohistochemistry with an antibody against Tenascin-C (1:300, EMD Millipore, Cat. ab19011), a strain-sensitive ECM protein known to be present in LUAD [9 ...
-
bioRxiv - Bioengineering 2019Quote: ... The antibodies used were mouse anti-human HSA (1:500; clone HSA-11, A6684; Sigma Aldrich; St. Louis, MO) and 10 nm colloidal gold-conjugated goat anti-mouse IgG (1:40 ...
-
bioRxiv - Pathology 2020Quote: ... the suspension adjusted to 1 × 106 parasites/mL in PBS and was incubated with 20% human complement (Sigma Aldrich). After 30 min ...
-
bioRxiv - Biochemistry 2019Quote: ... ti-sodium citrate and sodium hydroxide were purchased from Merck Company and Human serum albumin (96%) and ANS (1-anilino-8-naphthalene sulfonic acid) were purchased from Sigma-Aldrich.
-
bioRxiv - Neuroscience 2019Quote: After extensive washes in PB and 0.05 M Tris-buffered saline (pH 7.4; TBS) sections were blocked in 1 % human serum albumin (HSA; Sigma-Aldrich) in TBS ...
-
bioRxiv - Genetics 2020Quote: ... were co-expressed with the C-terminal domain of human DNMT3L (residues 178–386 of NCBI accession NM_175867) on a modified pRSFDuet-1 vector (Novagen), in which the DNMT3B or DNMT3A sequence was preceded by a hexahistidine (His6 ...
-
bioRxiv - Microbiology 2022Quote: ... difficile spores were incubated with 10 µg mL−1 of recombinant human purified E-cadherin (5085, Sigma-Aldrich, USA) with PBS for 1 h at 37 °C ...
-
bioRxiv - Immunology 2022Quote: ... Secondary incubation was performed with 1:20 000 dilution of HRP-conjugated anti-human IgG antibody (Sigma Aldrich SAB701283) for 1 hour at room temperature ...
-
bioRxiv - Immunology 2024Quote: ... blocked then incubated overnight at 4°C in primary antibody (rabbit anti-human STAT1 1:500, HPA000931, Sigma-Aldrich; mouse anti-human pSTAT1 1:1000 ...