Labshake search
Citations for Millipore Sigma :
2151 - 2200 of 10000+ citations for 6 Chloro 5 fluoro 1H indole 2 3 dione since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... Cat#D0540)] and 50μM APV [DL-2-Amino-5-phosphonopentanoic acid] (Sigma, Cat#A5282). After each experiment ...
-
bioRxiv - Biochemistry 2022Quote: ... plus a 5% (v/v) of 2-Mercaptoethanol (#M7154-25ML, Sigma-Aldrich)) ...
-
bioRxiv - Developmental Biology 2023Quote: ... mouse anti-Tubulin (1:3,000; Sigma clone B-5-1-2, T5168), and mouse anti-b-Actin (1:1,000 ...
-
bioRxiv - Developmental Biology 2023Quote: ... N-[2-(p-Bromocinnamylamino)ethyl]-5- isoquinolinesulfonamine dihydrochloride (H89, B1427, Sigma-Aldrich), were used in this study.
-
bioRxiv - Molecular Biology 2023Quote: ... and anti-α-tubulin B-5-1-2 monoclonal primary (T5168, Sigma), followed by goat-anti mouse IRDye 680 goat anti-mouse IgG secondary antibodies (926-68070 ...
-
Epigenetic deregulation of IFN and WNT pathways in AT2 cells impairs alveolar regeneration (in COPD)bioRxiv - Cell Biology 2023Quote: ... 48h later cells received 5-Aza-2’-deoxycytidine (0,5µM AZA, SIGMA, A3656) or DMSO and medium was replaced 48h after ...
-
bioRxiv - Cancer Biology 2021Quote: ... HsNHE9 targeting short hairpin RNA (shRNA) (5’-CCGGCCCTCCATTAAGGAGAGTTTTT CAAGAGAAAACTCTCCTTAATGGAGGTTTTTC-3’) and scramble control (Sigma-Aldrich) (5’-CAACAAGATGAAGAGCACCAA-3’ ...
-
bioRxiv - Developmental Biology 2021Quote: ... the culture medium was supplemented with 3 μM or 5 μM SU5402 (Sigma-Aldrich, SML0443) before live imaging ...
-
bioRxiv - Bioengineering 2019Quote: ... and 0.5 mM 8-Bromoadenosine 3’,5’-cyclic monophosphate (8-Br-cAMP; Sigma-Aldrich B5386) in EGM for 6 days [30–34] ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 0.5 mM 8-Bromoadenosine 3′,5′-cyclic monophosphate (8-Br-cAMP; B5386, Sigma Aldrich). After 48 hrs ...
-
bioRxiv - Cell Biology 2021Quote: ... with a 3:1 concentrated solution of 20 nm:5 nm colloidal gold (Sigma Aldrich) blocked with bovine serum albumin ...
-
bioRxiv - Bioengineering 2022Quote: ... 1 μM α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA, No.A6816, Sigma-Aldrich) is added in ACSF to enhance the Ca2+ signals ...
-
bioRxiv - Bioengineering 2022Quote: ... 4 μM α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA, No.A6816, Sigma-Aldrich) was initially added in HBSS buffer to enhance baseline Ca2+ signals ...
-
bioRxiv - Cell Biology 2019Quote: ... or the Kv7 channel activator retigabine (10−8 M to 3·10−5 M, Sigma). Some PAs were treated with XE991 (3·10-8-3·10-6 ...
-
bioRxiv - Genomics 2020Quote: ... into 384 well plates containing 3 μl of Smart-seq3 lysis buffer (5% PEG (Sigma), 0.10% Triton X-100 (Sigma) ...
-
bioRxiv - Neuroscience 2021Quote: ... A single-stranded oligo homology template (5’-ATGGACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGATTACAAGGATGACG ATGACAAGATGAGCACGGAGGTGAGCTGCCCTCAGGGGCTGTAAGGGACACCTTTGCTG-3’) was synthesized by Sigma Aldrich. The gRNA ...
-
bioRxiv - Cell Biology 2021Quote: ... Sig8-bromoadenosine 3′,5′-cyclic monophosphate sodium salt (8-Br-cAMP, Sigma-Aldrich, Darmstadt, Germany) at 0 hpi to a final concentration of 0.2 mM ...
-
bioRxiv - Molecular Biology 2022Quote: ... 0.1% Tween (Fisher)] containing either 5% non-fat milk powder or 3% BSA (Sigma-Aldrich) at room temperature for 40 minutes ...
-
bioRxiv - Physiology 2023Quote: ... The non-targeting shRNA sequence used as negative control was 5’-CAACAAGATGAAGAGCACCAA-3’ (Sigma-Aldrich). Lentivirus was collected beginning 48-hrs post-transfection and concentrated with Lenti-X Concentrator (Takara Bio USA ...
-
bioRxiv - Cell Biology 2023Quote: ... washed 3 times for 5 min in PBS and permeabilized with 0.5% NP-40 (Sigma) in PBS for 5 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... The following siRNAs were used in this study: siMis12C (Dharmacon siMIS12 5’-GACGUUGACUUUCUUUGAU-3’; Sigma siDSN1 5’-GUCUAUCAGUGUCGAUUUA-3’ ...
-
bioRxiv - Cell Biology 2024Quote: ... 3-5 kDa fluorescein isothiocyanate– dextran (FITC-dextran; 500 µg/ml, Sigma-Aldrich #FD4-100MG) was added to the culture media in the top channel ...
-
bioRxiv - Microbiology 2024Quote: Sulfamethoxazole (IUPAC: 4-Amino-N-(5-methylisoxazol-3-yl)-benzenesulfonamide) was purchased from Sigma-Aldrich, USA ...
-
bioRxiv - Immunology 2024Quote: ... washed 3 times with PBS and blocked with 5% bovine serum albumin (Sigma Aldrich, A9647) in PBS for 1 h ...
-
bioRxiv - Biochemistry 2021Quote: ... 6-Formylindolo[3,2-b]carbazole (FICZ) and 2-Methyl-2H-pyrazole-3-carboxylic acid (2-methyl-4-o-tolylazo-phenyl)-amide (CH-223191) from Sigma-Aldrich. 1-HP ...
-
bioRxiv - Biochemistry 2022Quote: ... they were cultivated 72 hours in the presence of 2 μM DL-threo-1-phenyl-2-palmitoylamino-3-morpholino-1-propanol (PPMP) (Sigma-Aldrich) to inhibit the synthesis of glucosylceramide-based GSLs 75 and incubated with fluorescent SaroL-1 as previously described ...
-
bioRxiv - Developmental Biology 2019Quote: ... 2 mg of protein lysate were incubated for 3 h with 2 μg of α-FLAG M2® antibody (Sigma-Aldrich) pre-coupled to 20 μl of rotein G Dynabeads® (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... the hippocampus and entorhinal cortex were dissected from the slices and positioned on a fluoro-carbon polymer porous membrane (Millipore, PICM0RG50) with 1 ml of slice culture medium beneath ...
-
bioRxiv - Cancer Biology 2023Quote: ... larvae were washed thrice in PBS containing 0.5% Triton X-100 (PBST) for 5 minutes and blocked with PBST containing 3% (w/v) Bovine Serum Albumin (Sigma-Aldrich, Gillingham, UK) for 1 h ...
-
bioRxiv - Bioengineering 2019Quote: Cy3-(GT)6-SWCNTs and Cy3-(GT)30-SWCNTs were first filtered 3 times using 100kDa Amicon centrifuge filters (Millipore) to remove free Cy3-DNA from solution ...
-
bioRxiv - Bioengineering 2019Quote: ... Laccase activity was followed by the oxidation of 2,2′-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) (Sigma-Aldrich, USA) (33) ...
-
bioRxiv - Biochemistry 2019Quote: ... 3 mM KCl) and harvested in a PBS lysis buffer (PBS plus 6 uL/mL protease inhibitors cocktail (Sigma P8340), 0.6 mM PMSF ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3 mL volumes of culture were transferred per well to 6-well tissue culture-treated polystyrene plates (Sigma CLS3506) and incubated at 23°C for 48 hours ...
-
bioRxiv - Cell Biology 2022Quote: ... Liposomes consisting of DPPC/egg yolk PC/egg yolk PG/cholesterol (6:3:1.2:0.95, DPPC from Avanti Polar Lipids, all other Sigma) with 0.6 μCi tracer [2-palmitoyl-1-14C]-dipalmitoyl phosphatidylcholine (14C-DPPC ...
-
bioRxiv - Microbiology 2022Quote: ... Samples were centrifuged 1800 rpm for 6 minutes at 4°C and pellets were resuspended n 3 mL RBC lysis for 4 minutes (Sigma). Samples were centrifuged 1800 rpm for 6 minutes at 4°C and the pellets were resuspended in 200 μl of PBS + 2% FBS + 2 mM EDTA ...
-
bioRxiv - Microbiology 2020Quote: ... and the resulting adhered bacteria on the cover slip were stained with 200 μL of the membrane stain N-(3-Triethylammoniumpropyl)-4-(6-(4-(Diethylamino) Phenyl) Hexatrienyl) Pyridinium Dibromide (FM4-64) (Sigma) at a final concentration of 20 μg/mL for 5 minutes ...
-
bioRxiv - Neuroscience 2019Quote: hNSG and non-engrafted NSG mice (4-6 months old) were injected 3 mg/kg (i.p.) with lipopolysaccharide (LPS from E. coli; O55:B5, Sigma-Aldrich) or 0.9% saline solution ...
-
bioRxiv - Molecular Biology 2021Quote: Total splenocytes were isolated from C57BL/6 and mFICD-/- mouse spleens and then treated for 3 days with 20 μg/ml LPS (Sigma), 100 µg/ml heparan sulfate or 2.5 μM thapsigargin (Enzo Life Sciences) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Lentiviral transductions were performed in a 6-well plate format (3 × 105 cells/well) using 10 µg/mL polybrene (Merck Millipore). Stably transduced cells were flow-sorted.
-
bioRxiv - Cell Biology 2022Quote: ... The following incubations ensued at room temperature: 3×10 min in 0.1 M maleic acid buffer (Sigma-Aldrich; pH 6), 2 h in the dark in 0.5% (w/v ...
-
bioRxiv - Neuroscience 2022Quote: ... using 0.5 mM EDTA and either re-seeded with split ratios (1:3 to 1:8) onto 6-well plates or cryopreserved using CryoStor CS10 Cryopreservation Reagent (Sigma). iPSC lines were maintained in 5% CO2 ...
-
bioRxiv - Immunology 2022Quote: ... Aliquots of 3 µl of between 3-6 mg/ml of Toll5A-Spz1C gel-filtered complex mixed with 8 mM CHAPSO (final concentration, Sigma) were applied to the grids ...
-
Transport of metformin metabolites by guanidinium exporters of the Small Multidrug Resistance familybioRxiv - Biophysics 2023Quote: ... 100 mM KCl and pre-loaded with 0.4 mM substrate (Gdm+ or guanylurea) and 1mM pyranine (trisodium 8-hydroxypyrene-1, 3, 6-trisulfonate; Sigma-Aldrich) using three freeze/thaw cycles ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 – 6 mg of cell extract and 20 μl of α-Flag M2 affinity bead suspension (Sigma, catalog no.: A2220) were used ...
-
bioRxiv - Cancer Biology 2023Quote: ... Organoids were passaged at a 1:3 to 1:6 ratio every 7 days using cell dissociation solution-non enzymatic (Sigma) and plated in fresh BME matrix droplets.
-
bioRxiv - Cell Biology 2020Quote: ... embryos/egg chambers were stained using 4′,6-diamidino-2-phenylindole (DAPI) (Sigma-Aldrich, St Louis, MO). Lipid droplets were stained using either Nile Red (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2021Quote: ... Slides were incubated in 4’,6-diamidino-2-phenylindole (DAPI) to label nuclei (1:10,000 dilution, Sigma). TUNEL assay was conducted with ApopTag Fluorescin Direct In Situ Apoptosis Detection Kit (Millipore ...
-
bioRxiv - Developmental Biology 2021Quote: ... the leaves were harvested and treated with 0.5 mg/ml DAPI (4ʹ,6-diamidino-2-phenylindole; Sigma). A Zeiss LSM 510 confocal scanning microscope was used to collect images.
-
bioRxiv - Neuroscience 2021Quote: ... brain slices were also stained by incubating with 4’,6-diamidino-2-phenylindole (DAPI, Sigma-Aldrich, USA) to mark all cell nuclei for 2 days ...
-
bioRxiv - Neuroscience 2021Quote: ... brain slices were also stained by incubating with 4’,6-diamidino-2-phenylindole (DAPI, Sigma-Aldrich, USA) to mark all cell nuclei for 30 min ...