Labshake search
Citations for Millipore Sigma :
2101 - 2150 of 10000+ citations for Cortisone Chemiluminescent ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... 5 μg/ml apo-transferrin (Sigma) and 13 ng/ml liothyronine (Sigma) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5 μl of Benzonase Nuclease (Novagen) and MgCl2 (1 mM final concentration ...
-
bioRxiv - Cancer Biology 2021Quote: ... and stained in 5% Giemsa (Sigma) for 15 minutes ...
-
bioRxiv - Neuroscience 2020Quote: ... Coumarin (Sigma-Aldrich, 91-64-5), Sucrose octaacetate (Aldrich ...
-
bioRxiv - Developmental Biology 2020Quote: 5-Bromo-2′-deoxyuridine (BrdU, Sigma) was dissolved in drinking water at a final concentration of 0.8 mg/ml and given to P28.5 mice for 7 consecutive days ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 5% donkey serum (Sigma-Aldrich) were added to the permeabilisation solution and this was also used for blocking for 1h at RT ...
-
bioRxiv - Biochemistry 2021Quote: ... supplemented with 5% horse serum (Sigma), 100 ng/ml cholera toxin (Sigma) ...
-
bioRxiv - Microbiology 2022Quote: ... SB290157 (Sigma, 1 μM 5 min), anti-CD18 clone GAME-46 or isotype control (BD ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 5% fetal bovine serum (Sigma) at 37 °C with 5% CO2 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 5 μg/L Vitamin B12 (Sigma), 4 mg/L FeSO4·7H2O (Sigma) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and 5 g/L glucose (Sigma). Cultures were grown in an anaerobic chamber with an atmosphere of 2% H2 balanced with N2 and CO2 at 37°C ...
-
bioRxiv - Immunology 2021Quote: ... Concanavalin A (Sigma, 5 μg/mL) was used as positive control ...
-
bioRxiv - Immunology 2021Quote: ... with 5% β-mercaptoethanol (Sigma-Aldrich). Samples were separated on 4% to 12% gradient gels (NuPAGE ...
-
bioRxiv - Neuroscience 2021Quote: ... pargyline (Sigma-Aldrich; 5 mg/kg), S(-)raclopride (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2021Quote: ... Coelenterazine-h (5 µM, Sigma-Aldrich) was then injected and the Renilla luciferase activity was assessed for the first 10 seconds using Infinite200Pro (Tecan ...
-
bioRxiv - Cell Biology 2019Quote: ... with 5% horse serum (HS) (Sigma), 10 µg/ml Insulin (Sigma) ...
-
bioRxiv - Microbiology 2020Quote: ... 5 mM ATP (A2383, Sigma Aldrich), and 0.03 % sodium cholate (Sigma Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... USP7 (5’CCCAAAUUAUUCCGCGGCAAA3’ from Sigma-Aldrich), the coding sequence of Chk1 (5’GAAGCAGUCGCAGUGAAGA3’ from Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2021Quote: ... 5% fetal bovine serum (FBS)(Sigma), 100U/ml penicillin and 100 μg/ml streptomycin (Nacalai Tesque ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 mM EGTA (Sigma cat. # E4378), 2 mM MgCl2 ...
-
bioRxiv - Cell Biology 2020Quote: ... 5-hydroxytryptamine creatinine sulfate complex (Sigma) was added to NGM agar plates to a final concentration of 20 mM ...
-
bioRxiv - Cell Biology 2020Quote: ... blocked with 5% BSA (Sigma A7906)/TBS-T for 1 hour ...
-
bioRxiv - Cell Biology 2020Quote: ... insulin (5 µg/ml, Sigma-Aldrich), hydrocortisone (0.36 µg/ml ...
-
bioRxiv - Cell Biology 2020Quote: ... insulin (5 µg/ml, Sigma-Aldrich), hydrocortisone (0.5 µg/ml ...
-
bioRxiv - Cell Biology 2020Quote: ... or Tim29 (5’ GGCUCUUCGAUGAGAAGUA 3’) (Sigma). Briefly ...
-
bioRxiv - Bioengineering 2020Quote: ... 5% goat serum (Sigma-Aldrich, UK) and 0.2% Triton-X 100 (Fisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... or 5% 1,6 hexanediol (Sigma-Aldrich) or 500ng/ml RNase A (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... For 5-fluorouracil (5FU; Sigma-Aldrich) treatment ...
-
bioRxiv - Cell Biology 2021Quote: ... and 5% skimmed milk (Sigma, #70166). Primary antibodies were diluted 1:1000 in this buffer and incubated overnight at 4°C with gentle shaking ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 5 mM imidazole (Sigma Aldrich). The suspension was briefly sonicated before homogenization through 1000-bar pressurized PANDAPLUS2000 (GEA) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 µM retinoic acid (Sigma-Aldrich) was also added to the media ...
-
bioRxiv - Microbiology 2019Quote: ... and 5 µM trimethoprim (TMP) (Sigma) and subsequently subjected to on and off cycling of blasticidin drug to promote integration of the plasmid in the main genome ...
-
bioRxiv - Neuroscience 2021Quote: ... 1µM 5-fluoro-2’-deoxyuridine (Sigma), penicillin and streptomycin ...
-
bioRxiv - Immunology 2020Quote: ... with 3 mg 5-fluorouracil (Sigma). Bone marrow was collected after 4 days and cultured in DMEM containing 15% FBS ...
-
bioRxiv - Immunology 2021Quote: ... 5 mg/mL ionomycin (Sigma-Aldrich) and a 1:1000 dilution of GolgiPlug (BD Bioscience ...
-
bioRxiv - Neuroscience 2020Quote: ... and 5 μg/mL insulin (Sigma). On day 4 ...
-
bioRxiv - Molecular Biology 2021Quote: ... or isoproterenol (5-25µM, Sigma-Aldrich) for 24 hours.
-
bioRxiv - Molecular Biology 2021Quote: ... 5 μg ArgC (Sigma-Aldrich, 11370529001) was resuspended in 50 μL ultrapure water (18.2 MΩ.cm resistivity ...
-
bioRxiv - Molecular Biology 2021Quote: ... + 5% charcoal stripped FBS (Sigma, F6765) + 1% pen/strep (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2021Quote: ... or 5 mM 3-MA (Sigma) were added during the 16-h incubation period ...
-
bioRxiv - Immunology 2020Quote: ... 1 mL of 5% carboxymethylcellulose (Sigma) diluted in Minimum Essential Media (Gibco ...
-
bioRxiv - Immunology 2020Quote: ... 50 μL of 5% TMA (Sigma) solution in 4:1 acetone/olive oil was applied to a shaved portion of the back on days 0 and 5 to sensitize the animals ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 μM DAPT (Sigma, D5942-5MG), and 1 μM DOX (Sigma ...
-
bioRxiv - Cell Biology 2021Quote: ... before blocking in 5% BSA (Sigma) in PBS with 0.1% Tween-20 (PBST) ...
-
bioRxiv - Immunology 2021Quote: ... 5 % Tween® 80 (Sigma-Aldrich) and 50 % distilled water ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 mM β-Glycerophosphate (Sigma #G6251), 1 mM phenylmethylsulfonyl fluoride (PMSF ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 μg/ml insulin (Sigma-Aldrich), 10 ng/ml EGF (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 μg/ml insulin (Sigma-Aldrich), 10 ng/ml EGF (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: ... and 5 mM DTT (Sigma, #D0632) treatments to determine the maximal and minimal oxidation capacities of the GRX1-roGFP2 sensor.
-
bioRxiv - Cell Biology 2019Quote: ... and 5 nM monensin (Sigma Aldrich). The fluorescence of each well was measured using a Varioskan Lux plate reader (Thermo Scientific ...