Labshake search
Citations for Millipore Sigma :
2051 - 2100 of 10000+ citations for Contactin Associated Protein Like 3 CNTNAP3 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... the sections were immersed in a solution of 0.05% 3-3’diaminobenzidine-4HCl (DAB, Sigma-Aldrich, St Louis, MO) and 0.05% hydrogen peroxide ...
-
bioRxiv - Immunology 2020Quote: The following reagents were used in this study: 3-methyladenine (3-MA; M9281; Sigma-Aldrich, St. Louis, MO, USA), dimethylsulfoxide (D2650 ...
-
bioRxiv - Biochemistry 2020Quote: ... Sequences for the HIF1α shRNA (shRNA10819 5’-CCGGTGCTCTTTGTGGTTGGATCTACTCGAGTAGATCCAACCACAAAGAGCATTTTT-3’ and shRNA3809 5’-CCGGCCAGTTATGATTGTGAAGTTACTCGAGTAACTTCACAATCATAACTGGTTTTT-3’) were obtained from Sigma Aldrich. Scrambled shRNA was used as negative controls ...
-
bioRxiv - Molecular Biology 2022Quote: ... fungal hyphae grown (for 2-3 weeks) in liquid M-C medium without Fe were exposed 3 days to 0.5 mM ferrozine (Sigma). This was done by replacing the liquid medium by 20 ml of a freshly prepared liquid M-C medium without Fe and supplemented with 0.5 mM ferrozine ...
-
bioRxiv - Microbiology 2019Quote: ... With primers comprising the respective restrictions sites (underlined) (F: 5’-3’ TGCAGACATATGAACCCCAACCACTCTG. R: 5’-3’ TACTAGAATTCCTAGACGCTCGATGTCGCC, Sigma-Aldrich, Germany), the full ORF was amplified from pCC2FOS-Mm3 by a standard PCR reaction using the Phusion DNA polymerase (New England BioLabs ...
-
bioRxiv - Developmental Biology 2020Quote: ... paws were incubated twice for 5min with methanol 50% BABB (1/3 benzylalcohol and 2/3 benzylbenzoate, from Sigma), and then three times in pure BABB for 5min each (or until the sample is cleared) ...
-
bioRxiv - Cancer Biology 2019Quote: CT26 cells that had been stably transduced with PCK1-targetting shRNA hairpins or control hairpins were grown in vitro for 3 days and counted on day 3 using the Sceptor 2.0 automated Cell counter (Millipore).
-
bioRxiv - Microbiology 2021Quote: ... harvested at day 3 and clarified by centrifugation at 350 x g for 15 minutes (Sigma 3-16K centrifuge). Viral stocks were concentrated by centrifugation at 11 ...
-
bioRxiv - Molecular Biology 2019Quote: ... or chemically crosslinked (small RNA blots) by incubation with 0.16 M l-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC, Sigma) in 0.13 M 1-methylimidazole (Sigma) ...
-
bioRxiv - Neuroscience 2020Quote: ... Sigma)10,42 and the metabotropic glutamate receptor antagonist DL-2-Amino-3-phosphonopropionic acid (AP-3) ([1mg/kg] in PBS, stock made in 1M NaOH diluted, pH 7.4; Sigma)10,43 ...
-
bioRxiv - Biophysics 2022Quote: Peak fractions of the PEAK3/14-3-3 complex were pooled and concentrated using an Amicon Ultra-0.5 30k MWCO centrifugal filter (Millipore). Immediately before preparing cryo-EM grids ...
-
bioRxiv - Cell Biology 2022Quote: ... The samples were separated on a Discovery HS F5-3 column (2.1 mm i.d. × 150 mm long, 3 µm particle size, Sigma–Aldrich) at a flow rate of 0.25 ml min−1 with a step gradient of mobile phase A (0.1% formic acid ...
-
bioRxiv - Microbiology 2022Quote: ... HFFs were infected with 5 ×⍰104 parasites per well and treated with 3 µM 3-MB-PP1 (MilliPore Sigma) or equivalent dilution of DMSO for 20 min prior to analysis.
-
bioRxiv - Neuroscience 2022Quote: ... 1 x 90 min) in 3% PBT (3% Triton-X-100 [CAS: 9002-93-1, Sigma Aldrich] in PBS) on ice ...
-
bioRxiv - Microbiology 2023Quote: ... was subjected to centrifugation through a 3 kDa cut-off membrane filter (Amicon Ultra-0.5 3-kDa Ultracell, Millipore) at 4 °C ...
-
bioRxiv - Bioengineering 2023Quote: ... coverslips were thiol-silanised by submerging for 3 hrs in a 10% solution of (3-Mercaptopropyl)trimethoxysilane (Sigma-Aldrich) in toluene before tempering by incubating at 100°C for 1 hr.
-
bioRxiv - Plant Biology 2023Quote: ... benthamiana leaves with expressing effectors were immersed in 1 mg/ml DAB (3, 3′-diaminobenzidine) solution (Sigma-Aldrich, USA) at 25°C for 8 h ...
-
bioRxiv - Immunology 2023Quote: ... SRBCs in Alsever’s (TCS Bioscience) were conjugated to recombinant HEL3X (R. Brink) with 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (Sigma) as previously described104 ...
-
bioRxiv - Molecular Biology 2023Quote: ... two siRNAs targeting this RBP (siPTBP1) were transfected into HeLa cells (siPTBP1_1: 5’-GCACAGUGUUGAAGAUCAU-3’; siPTBP1_2: 5’-AACUUCCAUCAUUCCAGAGAA-3’; Sigma-Aldrich), using the jetPRIME® (Polyplus Transfection ...
-
bioRxiv - Cell Biology 2023Quote: ... 5’CGUACGCGGAAUACUUCGA[dU][dU]3’) and Cofilin-1 (5’CCUCUAUGAUGCAACCUAU[dU][dU]3’)[78] have been synthetized by Sigma. In rescue experiments ...
-
bioRxiv - Immunology 2023Quote: ... 2 and 3 were detected with another multiplex assay (MILLIPLEX MAP TGFß Magnetic Bead 3 Plex Kit; Merck Millipore).
-
bioRxiv - Neuroscience 2024Quote: ... the sections were immersed in a solution of 0.05% 3-3’diaminobenzidine-4HCl (DAB, Sigma-Aldrich, St Louis, MO) and 0.05% hydrogen peroxide ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were separated on a Discovery HS F5-3 column (2.1 mm i.d. × 150 mm, particle size 3 μm, Sigma-Aldrich) using mobile phase A (0.1% formic acid/water ...
-
bioRxiv - Molecular Biology 2020Quote: ... protein was isolated from cells using 300μl CytoBuster™ Protein Extraction Reagent (Novagen) per well according to manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2022Quote: ... Protein concentrations were determined with the BCA protein assay kit (Novagen, Merck KGaA), and protein homogeneity was analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE ...
-
bioRxiv - Plant Biology 2021Quote: ... Protein extracts were performed with the Plant Total Protein Extraction Kit (Sigma, USA). Protein concentrations were measured using the BCA method ...
-
bioRxiv - Cancer Biology 2019Quote: ... Lysates were sonicated and protein concentration was determined using BCA protein assay (Sigma). 30 μg of total proteins were loaded on 12% SDS–PAGE gel and separated by electrophoresis ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... a marker of protein oxidation (protein carbonyls; OxyBlot; s7150; EMD Millipore, Billerica, MA), and a marker of mitochondrial biogenesis (PGC-1α ...
-
bioRxiv - Plant Biology 2020Quote: ... were subjected to protein extraction using Plant Total Protein Extraction Kit (Sigma-Aldrich). The protein concentration was measured using 2-D Quant Kit (GE Healthcare ...
-
bioRxiv - Genomics 2019Quote: Duolink PLA kit was used to detect protein-protein interactions (Sigma Aldrich DUO92101). PLA was performed according to manufacturer’s protocol plus additional negative controls ...
-
bioRxiv - Genetics 2020Quote: ... Protein concentrations were analyzed with a Bicinchoninic Acid Protein Assay Kit (Sigma-Aldrich), using bovine serum albumin as a standard ...
-
bioRxiv - Immunology 2020Quote: Total proteins isolated from BMDCs were lysed in CytoBuster protein extraction reagent (Novagen). Protein quantification was performed using NanoDrop One Spectrophotometer ...
-
bioRxiv - Cell Biology 2022Quote: ... the other stained for proteins with SYPRO Red Protein Gel Stain (Sigma Aldrich). Both dyes were used according to the manufacturers’ protocols.
-
bioRxiv - Microbiology 2022Quote: ... total cell protein was measured using the bicinchoninic acid protein assay (Sigma-Aldrich) against bovine serum albumin standards ...
-
bioRxiv - Cancer Biology 2023Quote: Oxidized proteins were detected using the OxyBlot Protein Oxidation Detection Kit (Sigma, S7150) and following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... The protein concentration was quantified using bicinchoninic acid (BCA) Protein assay (Sigma-Aldrich). Then 60 μg of the total protein of each genotype was separated on 8% SDS-PAGE and transferred to the PVDF membrane (Amersham ...
-
bioRxiv - Microbiology 2023Quote: ... 1000 µg of protein extracts were cleared with agarose protein A beads (Millipore) at 4 ℃ for 1.5 h on a rocking platform ...
-
bioRxiv - Microbiology 2023Quote: ... or with slurry protein G beads (Sigma-Aldrich Fast Flow Protein G sepharose). For GFP-p65 and GFP-COMMD2 the samples were immunoprecipitated as per manufacturer’s instructions with the elution was recovered in either 5x with Laemmli buffer 74 and boiled at 98°C (dry bath ...
-
bioRxiv - Plant Biology 2023Quote: ... the protein extract was incubated with 30 μL Protein A Agarose beads (Millipore), 10 μL anti-SIZ1 antibody with rotation at 4°C for 4 h.
-
bioRxiv - Microbiology 2023Quote: ... The protein was purified using a Protein A agarose gravity column (Millipore Sigma) followed by SEC using a S200 column.
-
bioRxiv - Biochemistry 2023Quote: ... Protein concentrations were determined with the BCA protein assay kit from Sigma-Aldrich.
-
bioRxiv - Molecular Biology 2024Quote: The protein mixtures were filtered using a low protein binding filter (Millipore Sigma) and purified on a SourceQ15 anion exchange column (Cytiva ...
-
bioRxiv - Genomics 2024Quote: ... Protein transfer and total protein content was assessed by Ponceau Staining (Sigma Aldrich). Ponceau Stain was washed out with 1x TBST ...
-
bioRxiv - Genetics 2024Quote: ... protein concentration was measured by use of a BCA Protein Assay (SIGMA Aldrich) and samples stored at -80°C.
-
bioRxiv - Molecular Biology 2021Quote: Protein-G (Protein G Sepharose® 4 Fast, cat# GE17-0618-01) or Protein-A (ProteinA-Sepharose® 4, cat#P9424 Millipore) beads were washed twice with 1x PBS and twice with IP100 buffer (25 mM Tris-HCl 7.9 ...
-
bioRxiv - Cell Biology 2020Quote: ... R-spondin 3 and Noggin were selected during the 3 first days post seeding by adding 0.5 mg/mL G418 (Sigma-Aldrich) and 0.5 mg/mL Hygromycin B (InvivoGen ...
-
bioRxiv - Developmental Biology 2020Quote: ... Osteogenic differentiation was performed in osteogenic medium (Cyagen, GUXMX-90021) for 3 weeks (medium was changed every 3 days) and quantified by alizarin red staining (Sigma) and qPCR ...
-
bioRxiv - Cell Biology 2019Quote: Cells were washed with PBS then incubated with CSK buffer 3 times for 3 minutes and once for half minute [10 mM Hepes pH 7.0 (Sigma-Aldrich), 100 mM sucrose (Sigma-Aldrich) ...
-
bioRxiv - Plant Biology 2019Quote: ... Y187 strains were grown on SD/-Trp-Leu medium and transferred to SD/-Trp-Leu-His medium with 10 mM 3-aminotriazole (3-AT, Sigma) in gradient dilutions (1:10 ...
-
bioRxiv - Genetics 2019Quote: ... Aliquots of 1-3 x 109 cells in 150 ml YPD/synthetic medium were fixed in 3% formaldehyde (Sigma, F8775) for 20 min at room temperature and quenched with 25 ml glycine 2.5 M for 20 min at 4°C ...