Labshake search
Citations for Millipore Sigma :
2051 - 2100 of 10000+ citations for 4 Nitro n propan 2 yl aniline since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: ... N-hexanoyl-L-homoserine lactone (C6-HSL) and N-3-oxotetradecanoyl-L-homoserine lactone (oxo-C14-HSL) (Sigma-Aldrich) at concentrations as indicated were used in this study.
-
bioRxiv - Biochemistry 2022Quote: ... followed by another incubation with 20 µL N-(tert-butyldimethylsilyl)-N-methyl-trifluoroacetamide with 1% tert-Butyldimethylchlorosilane (TBDMS) (Sigma) at 60 °C for 1 hour ...
-
bioRxiv - Physiology 2023Quote: ... followed by derivatization with 20 µl of N-tert-butyldimethylsilyl-N-methyltrifluoroacetamide with 1% tert-butyldimethylchlorosilane (Millipore Sigma 375934) for 30 min at 60°C ...
-
bioRxiv - Physiology 2024Quote: ... and silanized at 300°C in an atmosphere of N,N-dimethyltrimethyl silylamine (Sigma Aldrich, St. Louis, MO, USA). From here ...
-
bioRxiv - Neuroscience 2022Quote: Lesion animals (n=18) received bilateral excitotoxic HPCv lesions via intracranial injections of N-methyl-d-aspartate (NMDA, Sigma, St-Louis ...
-
bioRxiv - Biochemistry 2024Quote: ... The positive control for the glucosylceramide N-deacylase assay was recombinant Sphingolipid ceramide N-deacylase (SCDase; Sigma-Aldrich, S2563).
-
bioRxiv - Biochemistry 2024Quote: ... The positive control for the glycolipid N-deacylase assay was recombinant Sphingolipid ceramide N-deacylase (SCDase; Sigma-Aldrich, S2563) (76) ...
-
bioRxiv - Neuroscience 2024Quote: Stock solutions (1mg/ml) of 1,1′-dioctadecyl-3,3,3′,3′-tetramethylindocarbocyanine perchlorate (DiI) in N,N-dimethylformamide (Sigma-Aldrich 468495) were stored at −20°C ...
-
bioRxiv - Genomics 2024Quote: ... One hundred microliters of the supernatant was mixed with 100µl 200mM 3-Nitrophenylhydrazine hydrochloride (3NPH in 50% ACN) and 100µl 120mM N-(3-dimethylaminopropyl)- N’-ethylcarbodiimide hydrochloride (EDC in 50% ACN with 6% pyridine) (both Sigma) in a low-binding Eppendorf tube ...
-
bioRxiv - Bioengineering 2024Quote: ... 1 μM purmorphamine and 5 μM N-{N-(3,5-difluorophenacetyl-l-alanyl))-(S)-phenylglycine-t-butyl-ester (DAPT; Sigma). At day 6 ...
-
bioRxiv - Cancer Biology 2024Quote: ... followed by derivatization with 20 µl of N-tert-butyldimethylsilyl-N-methyltrifluoroacetamide with 1% tert-butyldimethylchlorosilane (Millipore Sigma 375934) for 30 min at 60°C ...
-
bioRxiv - Cell Biology 2021Quote: ... 4-hydroxytamoxifen (4-OHT) (Sigma) was prepared by dissolution in ethanol (10% ...
-
bioRxiv - Developmental Biology 2021Quote: 4-hydroxytamoxifen (4-OHT, Sigma) was dissolved in 100% ethanol to prepare a stock concentration of 10 mM ...
-
bioRxiv - Biophysics 2020Quote: ... were added to 1 mL of 10 mg∙mL−1 of N-(3-dimethylaminopropyl)-N’-ethylcabodiimidie hydrochloride (EDC, Sigma-Aldrich) dissolved in 100 mM sodium phosphate ...
-
bioRxiv - Microbiology 2021Quote: ... the samples were dissolved in 50 μL of 20 mg/ml methoxyamine hydrochloride in pyridine for 1.5 h at 33°C followed by derivatization with N-Methyl-N-(trymethylsolyl)trifluoroacetamide (MSTFA, Sigma Aldrich) for 2 h at 35°C.
-
Interactions with stromal cells promote a more oxidized cancer cell redox state in pancreatic tumorsbioRxiv - Cancer Biology 2020Quote: ... and incubated at 37° C for 90 minutes followed by addition of 20μL N–methyl–N–(tert–butyldimethylsilyl)trifluoroacetamide + 1% tert–Butyldimethylchlorosilane (Sigma 375934) and incubated at 60°C for 1 hour ...
-
bioRxiv - Cancer Biology 2020Quote: ... and incubated at 37°C for 90 minutes followed by addition of 20µL N–methyl–N–(tert–butyldimethylsilyl)trifluoroacetamide + 1% tert– Butyldimethylchlorosilane (Sigma 375934) and incubated at 60°C for 1 hour ...
-
bioRxiv - Plant Biology 2020Quote: ... The combined organic phase was dried using CentriVap Cold Traps (Labconco) and derivatized using bis-(N,N,-trimethylsilyl)-tri-fluoroacetamide (BSTFA; Sigma) as described previously (Franke et al. ...
-
bioRxiv - Microbiology 2021Quote: ... Terminal cellular differentiation was induced with 10 μM N-[N-(3,5-Difluorophenacetyl)-L-alanyl]-S-phenylglycine t-butyl ester (DAPT; Sigma-Aldrich) while mucus-secretion was enhanced with 10 nM phorbol 12-myristate 13-acetate (PMA ...
-
bioRxiv - Cell Biology 2021Quote: SK-N-SH-N cells were plated onto 6-well tissue culture plates coated with poly-L-lysine (Sigma-Aldrich). Cells were plated at 3×105 cells/ml in MEMα medium containing a very low-serum level (2% FBS) ...
-
bioRxiv - Cancer Biology 2022Quote: ... for 1h at 37°C and then with 20μL 1% tert-butyldimethylchlorosilane in N-tert-Butyldimethylsilyl-N-methyltrifluoroacetamide (Sigma Aldrich) for 3h at 60°C ...
-
bioRxiv - Cell Biology 2022Quote: ... in pyridine at 70°C for 15 min followed by addition of N-tert-Butyldimethylsiyl-N-methyltrifluoroacetamide (MTBSTFA, Sigma-Aldrich) for 1 hour ...
-
bioRxiv - Plant Biology 2021Quote: ... The sample was then derivatized by adding 60 μL N-methyl-N-(trimethylsilyl)trifluoro acetamide (MSTFA) (Cat# 69479; Sigma-Aldrich) and incubating for 30 min at 37 °C ...
-
bioRxiv - Cancer Biology 2022Quote: ... The gelatin was subsequently cross-linked using N-(3-Dimethylaminopropyl)-N’-ethylcarbodiimide hydrochloride (EDC hydrochloride) (Sigma Aldrich Catalog No-03450) and N-Hydroxysuccinimide (NHS ...
-
bioRxiv - Neuroscience 2020Quote: ... cells were treated for 16 hours with N-[N-(3,5-Difluorophenacetyl)-L-alanyl]-phenylglycin T-butyl ester (DAPT) (Sigma Aldrich), an inhibitor of γ-secretase ...
-
bioRxiv - Microbiology 2022Quote: ... The dried remainder of eluate 2 was dissolved in 50 µl dry acetonitrile and 50 µl N-(tert-butyldimethylsilyl)-N-methyltrifluoroacetamide containing 1% tert-butyldimethylsilyl chloride (Sigma) and kept at 70°C for 30 min ...
-
Evolution of protease activation and specificity via alpha-2-macroglobulin-mediated covalent capturebioRxiv - Synthetic Biology 2023Quote: ... To the bead suspension was added 0.5 mL of 750 mM of N-(3-dimethylaminopropyl)-N’-ethylcarbodiimide hydrochloride (EDC) in water (Sigma-Aldrich) and the mixture was incubated for 20 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... animals were injected with N-[N-(3,5-Difluorophenacetyl)-L-alanyl]-S-phenylglycine t-butyl ester (DAPT) (Sigma, Cat no. D5942) (10 mg/kg/day ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... The ML321 was dissolved in a small amount of N,N-dimethylacetamide (DMA) with previously heated Tween-80 (Sigma-Aldrich) and vortexed until the solution was solubilized ...
-
bioRxiv - Developmental Biology 2023Quote: ... we prepared NGM dishes as above and added paraquat (N,N’-dimethyl-4,4’-bipyridium dichloride, 36541, Sigma-Aldrich, Burlington MA) to the molten agar to a final concentration of 40 mM ...
-
bioRxiv - Cancer Biology 2023Quote: ... The samples were then further incubated with 20 µL of N-(tert-butyldimethylsilyl)-N-methyl-trifluoroacetamide with 1% tert-Butyldimethylchlorosilane (TBDMS) (Sigma) at 60 °C for 60 min ...
-
bioRxiv - Neuroscience 2023Quote: ... Adult female SNSiDTR (n=6) and TrkBiDTR (n=19) mice were injected i.p with 40 μg/kg DTX (Sigma, D0564) with a second dose after 72 h ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Dried samples were first resuspended in a 1:1 v/v mixture of a 1% solution of N,N-diisopropylethylamine (Sigma) and a 1% solution of pentaflurobenzylbromine (Sigma ...
-
bioRxiv - Genetics 2023Quote: ... Pregnant female mice were given one intraperitoneal (i.p.) injection of 30 mg/kg body weight of the carcinogen N-ethyl-N-nitrosourea (ENU, Sigma N3385) dissolved in phosphate-buffered citric acid (pH 5.8 ...
-
bioRxiv - Microbiology 2023Quote: ... expressing mammalian expression vector was generated by subcloning CHPV-N gene from PET-3a-CHPV-N plasmid (gift from Dr. Dhrubajyoti Chattopadhayay) in pFLAG-CMV6a (Sigma). Primers F-5’ TTTATA AAGCTT ATGAGTTCTCAAGTATTC3’ and R-5’ TTTATA GGATCCTCATGCAAAGAGTTTCCT3’ containing the Hind III and BamHI sites respectively were used to amplify CHPV-N gene ...
-
bioRxiv - Molecular Biology 2023Quote: ... ascending aorta of 10 animals (TBAV: n=5; HTAV: n=5) were incubated in 4,5-diaminofluorescein diacetate (DAF-2DA; Sigma-Aldrich) as previously described20 ...
-
bioRxiv - Neuroscience 2024Quote: ... The antibodies used were GluA1-N (NeuroMab, SKU: 75-327, 1:100) and GluA2-N (Millipore, Cat# MAB397, 1:100). For standard labeling ...
-
bioRxiv - Microbiology 2024Quote: ... Other carbon sources (acetate, glucose, glucosamine, N-acetyl-D-glucosamine, galactose, N-acetyl-D-galactosamine, fucose, mannose, and sialic acid; Sigma) were added to M9 minimal medium at a concentration of 10 mM.
-
bioRxiv - Immunology 2024Quote: ... 50 mM of iodoacetamide (BioUltra, Millipore Sigma #I1149) (1 M stock in anhydrous N, N-Dimethylformamide (DMF (Millipore Sigma #227056)) ...
-
bioRxiv - Cell Biology 2024Quote: ... gels were incubated in a third gelling solution (19% SA, 10% AAm, 0.1% N,N′-methylenebis(acrylamide) (BIS; Sigma, 14602), 0.05% APS and 0.05% TEMED ...
-
bioRxiv - Cell Biology 2024Quote: ... then incubated in a MES buffer solution containing 50 mg/ml N(3Dimethylaminopropyl)-N′-ethylcarbodiimide hydrochloride (EDC, Sigma Aldrich, E7750) and 50 mg/ml NHydroxysuccinimide (NHS ...
-
bioRxiv - Cancer Biology 2021Quote: ... For AR and FOXA1 ChIP organoids were double fixed (Singh et al., 2019) with 2 mM Di(N-succinimidyl) glutarate (Millipore Signal, Cat #80424-5MG-F) and then 1% formaldehyde ...
-
bioRxiv - Cell Biology 2020Quote: ... 3-Isobutyl-1-methylxanthine (IBMX, ≥ 99%), N-acetyl-L-cysteine (NAC, ≥ 99%) and 2′,7′-dichlorofluorescin diacetate (DCFH-DA, ≥ 97%) were purchased from Sigma-Aldrich (St. Louis, MO, USA). Pregnant mare serum gonadotropin (PMSG ...
-
bioRxiv - Neuroscience 2020Quote: ... fixed with vacuum grease and kept in physiological Tyrode’s solution for imaging (in mM: 120 NaCl, 2.5 KCl, 30 glucose, 2 CaCl2, 1 MgCl2, and 20 HEPES; Sigma Aldrich; pH = 7.2-7.4; n = 1.33).
-
bioRxiv - Microbiology 2022Quote: The AHL signaling molecules used in this study are N-(3-oxododecanoyl)-L-homoserine lactone (3-oxo-C12-HSL, Sigma-Aldrich CAS# 168982-69-2), N-butyryl-homoserine lactone (C4-HSL ...
-
bioRxiv - Biophysics 2021Quote: ... n-octylglucoside (OG, Sigma-Aldrich, St. Louis, MO), 3-((3-cholamidopropyl ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1 mM N-Acetyl-L-cysteine (Sigma Aldrich) and 10 mM Heregulin Beta-1 (PeproTech).
-
bioRxiv - Cell Biology 2020Quote: N-Acetyl-L-cysteine (cat# A7250, Sigma-Aldrich)
-
bioRxiv - Developmental Biology 2021Quote: ... 1 μM N-Acetyl-L-cysteine (Sigma-Aldrich). 10 μM Y-27632 was added for the first two days of culture ...
-
bioRxiv - Immunology 2021Quote: ... 0.5% n-Octyl-β-D-glucopyranoside (Merck Millipore). Finally lysates were subjected to chromatin shearing with Qsonica Sonicator Q700 (Thermoscientific ...