Labshake search
Citations for Millipore Sigma :
2001 - 2050 of 10000+ citations for IL 5 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: FDT standards were prepared in human plasma (Sigma Aldrich), whereby 20 μL plasma samples were spiked with various known concentrations of [19F]FDT i.e ...
-
bioRxiv - Immunology 2023Quote: ... were coated with goat anti-human IgG (Sigma #I2136) antibody at a concentration of 4 µg/ ml diluted in PBS ...
-
bioRxiv - Cell Biology 2023Quote: ... Human A2780 cells (catalog #: 93112519) were purchased from Sigma. Cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM ...
-
bioRxiv - Developmental Biology 2024Quote: ... 0.5 mg/ml human recombinant albumin (Sigma Aldrich, A9731) and 0.2 mg/ml L-ascorbic acid 2-phosphate (Sigma Aldrich ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 2.5 μg/ml human recombinant insulin (Sigma, 19278). Wide-bore P1000 pipette tips with ∼3 mm diameter openings were used to transfer tumor pieces ...
-
bioRxiv - Cell Biology 2024Quote: pFN (human plasma FN (FC010) (Millipore,Burlington, MA, USA) was labelled with AlexaFluor568 or AlexaFluro680 according to instructions of the manufacturer (ThermoFisher ...
-
bioRxiv - Microbiology 2023Quote: ... and 200 μL human serum (Sigma, St. Louis, MO). One 10 mL tube of whole blood yielded 1 mL of neutrophil-only solution ...
-
bioRxiv - Molecular Biology 2023Quote: ... of Human chorionic gonadotropin (hCG) (Millipore Sigma, CG5-1VL). At 16 h post hCG injection ...
-
bioRxiv - Cancer Biology 2023Quote: ... supplemented with 1% human serum (Sigma Aldrich Cat #H6914), 1% P/S ...
-
bioRxiv - Bioengineering 2023Quote: ... 0.135 ng/mL human vascular endothelial growth factor (Sigma), 1 μg/mL hydrocortisone (Sigma) ...
-
bioRxiv - Cell Biology 2023Quote: ... 10 µg/ml human insulin (Sigma-Aldrich, cat.no. I9278), 0.5 µg/ml hydrocortisone (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2023Quote: ... mouse monoclonal anti-human NEFH (Sigma [ab142]; 1:400), rabbit antihuman SST (ImmunoStar 20067 ...
-
bioRxiv - Immunology 2024Quote: 100μg of Human Immunoglobulin type G (Sigma-Aldrich, 14506) or Bovin Serum Albumin are covalently linked to 3μm Polybead® Carboxylate Microspheres with PolyLink Protein Coupling Kit following manufacturer instructions ...
-
bioRxiv - Bioengineering 2024Quote: ... anti-human nuclei (HuNu; 1:100; MAB4383, Merck Millipore), and anti-E-cadherin-1 (ECAD ...
-
bioRxiv - Microbiology 2024Quote: ... 10 µg per mL of human transferrin (Sigma-Aldrich) was included in the growth medium ...
-
bioRxiv - Microbiology 2023Quote: RENcell VM Human Neural Progenitor Cell Line (Sigma Aldrich) were cultured in medium comprising DMEM F-12 (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2024Quote: ... 350 μL insulin human recombinant (Sigma-Aldritch, Cat. 11376497001)) supplemented with bFGF (10 ng/mL ...
-
bioRxiv - Cancer Biology 2024Quote: ... and mouse anti-human anti-Vimentin (Sigma-Aldrich, CBL202) in 0.5% (v/v ...
-
bioRxiv - Genetics 2024Quote: The AC16 human cardiomyocyte cell line (Millipore Sigma SCC109) was cultured in Dulbecco’s Modified Eagle’s Medium ...
-
bioRxiv - Cancer Biology 2024Quote: ... 10% heat inactivated Human AB serum (HS, Sigma-Aldrich), 6000 IU/ml recombinant human IL2 (Peprotech) ...
-
bioRxiv - Neuroscience 2024Quote: ... Ovulation was induced with human chorionic gonadotropin (Sigma CG10), and embryos were collected and manipulated according to standard procedure58 ...
-
bioRxiv - Pathology 2024Quote: To prepare the COLIV (derived from human placenta-Sigma) stock solution ...
-
bioRxiv - Neuroscience 2024Quote: ... 1:4000 human insulin (9.5-11.5 mg/mL; Sigma). The next day ...
-
bioRxiv - Cancer Biology 2024Quote: ... or mouse anti-human BCL-XL (EMD Millipore MAB3121) antibodies were added to lysate aliquots and incubated at 4°C overnight ...
-
bioRxiv - Immunology 2024Quote: ... human myeloma IgE (0.3 µg/mL, Sigma-Aldrich, #401152) was used for sensitizing the cells in the presence of recombinant human IL-4 (Gibco ...
-
bioRxiv - Neuroscience 2024Quote: ... human leukemia inhibitory factor (hLIF, 10 ng/ml, Millipore), SB431542 (2 µM) ...
-
bioRxiv - Genomics 2021Quote: ... Cells were stimulated with 1 μg/ml Resiquimod (Enzo) and 50 ng/ml IL-2 (Sigma). BrdU (40 μM ...
-
bioRxiv - Biochemistry 2022Quote: ... supplemented with Halt Protease Inhibitor (Pierce, Rockford, IL) and benzonase (Millipore Sigma, St. Louis, MO, USA) for 15 minutes at RT ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... IL-10 concentrations were determined with MILLIPLEX MAP Porcine Cytokine/Chemokine Magnetic Bead Panel (Merck-Millipore) with strict adherence to the manufacturer’s instructions.
-
bioRxiv - Physiology 2022Quote: ... IL-1β+AngII cells whose culture medium was further supplemented with 5μM of Tamoxifen citrate (Sigma) and LOS+TAM ...
-
bioRxiv - Immunology 2024Quote: ... IL-13-FITC antibodies after PMA (30 nM) and Ionomycin (1,5 µM) (both Sigma-Aldrich, USA) restimulation in the presence of Golgi Plug ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The cell lysates were transferred to a 96-well plate and reactions were initiated by adding 1 mM 5-thiobutyl butyrolactone (TBBL) and 1 mM 5′,5-dithiobis (2-nitrobenzoic acid) (DTNB) (Sigma Aldrich, D8130) in Pon2 activity assay buffer ...
-
bioRxiv - Immunology 2019Quote: ... inhibitors on the autophagic flux pathways (3-MA, 5 μM, Sigma-Aldrich; chloroquine, 5 μM, Sigma-Aldrich; bafilomycin, 5 μM, Sigma-Aldrich), and inhibitors on the mTOR pathway (Rapamycin ...
-
bioRxiv - Immunology 2019Quote: ... inhibitors on the autophagic flux pathways (3-MA, 5 μM, Sigma-Aldrich; chloroquine, 5 μM, Sigma-Aldrich; bafilomycin, 5 μM, Sigma-Aldrich), and inhibitors on the mTOR pathway (Rapamycin ...
-
bioRxiv - Cell Biology 2022Quote: ... Lipids were separated using a solvent mixture of triethylamine/chloroform/ethanol/water (5:5:5:1, v/v) (all solvents HPLC grade, Sigma-Aldrich, USA) as mobile phase in a solvent vapour saturated twin trough chamber (CAMAG ...
-
bioRxiv - Cell Biology 2023Quote: ... FAIK3-5 were treated with 1 µM of the hypomethylating agent 5-Azacytidine (5-Aza, Sigma-Aldrich, St. Louis, MO, United States) in an additional approach ...
-
bioRxiv - Neuroscience 2019Quote: ... Membranes were then washed twice 5 min in TBST and incubated with the primary antibody over night at 4°C (human and mouse a-syn: 610786 BD Biosciences; human α-syn: 804-258-1001, Enzo Life Science; beta-actin: A4700, Sigma). After incubation with the first antibody ...
-
bioRxiv - Immunology 2022Quote: Concentrations of human serum albumin in human plasma and bronchoalveloar lavage fluid were measured using an ELISA kit from Sigma Aldrich (Cat. #RAB0603) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... Antibodies for immunostaining included rabbit anti-human/mouse PKD-1 (SAB4502371) and mouse anti-human/mouse α-smooth muscle actin (α-SMA, A2547) (Sigma-Aldrich), mouse anti-human/rat CD44 (5640S ...
-
bioRxiv - Developmental Biology 2024Quote: ... anti-Ku80 (CST, #2180, 1:400), anti-human nuclear antigen (Novus NBP2-34342, 1:200) and anti-human-specific Albumin (Sigma, A3293, 1:200). Species-specific secondary antibodies conjugated with Alexa Fluor 555 ...
-
bioRxiv - Neuroscience 2022Quote: To inject a dopamine transporter (DAT) inhibitor (GBR12909, D052, Sigma Aldrich, MO, 5 mg/ml in distilled water with 5% dimethyl sulfoxide, 67-68-5, Sigma Aldrich, MO) or vehicle (distilled water with 5% dimethyl sulfoxide) ...
-
bioRxiv - Pathology 2023Quote: ... The solvent (n=5) or an FXIa inhibitor (ONO-1600586, 3 µmol/L n=5) and mepacrine (Sigma-Aldrich; final concentration 5 µM) were added to the blood before perfusion ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-Vinculin (Vin-11-5) (1:5000; Sigma-Aldrich, SAB4200729, Vin-11-5), mouse anti-α-tubulin (B-5-1-2 ...
-
bioRxiv - Genomics 2019Quote: ... with primers 5’ GAGCTGGACGGCGACGTAAACG 3’ and 5’ CGCTTCTCGTTGGGGTCTTTGCT 3’ for amplification (Sigma-Aldrich, Germany). The PCR amplification was as follows ...
-
bioRxiv - Cell Biology 2021Quote: ... 100 ng/μL NGF and 40 μM 5-UfDU (uridine and 5-fluorodeoxyuridine, Sigma). Cultures were maintained at 37°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... then treated with 1 uM of 5-Aza-2-deoxycytidine (5 –Aza, SIGMA, A3656) or PBS for 4 days ...
-
bioRxiv - Genetics 2022Quote: ... was diluted in molecular biology-grade water and 5-fluorouracil (5-FU) (Sigma-Aldrich) diluted in dimethyl sulfoxide (SigmaAldrich) ...
-
bioRxiv - Immunology 2022Quote: ... 5% CO2.with a mixture of 5 μg/mL polybrene (Sigma TR-1003-G) and pseudovirus diluted to a titer that produces 1*108 total integrated intensity units/mL ...
-
bioRxiv - Microbiology 2021Quote: ... media was supplemented with 50 mg L−1 5-aminolevulinic acid (5-ala, Sigma). When appropriate ...
-
bioRxiv - Microbiology 2021Quote: ... Top2β: Forward primer 5’CAGCCCGAAAGACCTAAATAC and reverse primer 5’ATCTAACCCATCTGAAGGAAC obtained from Sigma-Aldrich.