Labshake search
Citations for Millipore Sigma :
2001 - 2050 of 10000+ citations for Benzyl 2 3 4 5 6 d5 dimethyltetradecylammonium Bromide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... 0.0267 µg/ml d5-TG Internal Standard Mixture I (Avanti, LM6000) and 0.1 μg/ml Palmitic acid-13C (Sigma, 605573). The tubes were vortexed and then sonicated for 30 min in an ice-cold sonication bath (taken for a brief vortex every 10 min) ...
-
bioRxiv - Molecular Biology 2021Quote: ... to YPD containing 5 mM 4-thiouracil (Sigma, 440736-1G). Cells were incubated with 4tU for 5 minutes before pelleting (one minute ...
-
bioRxiv - Neuroscience 2021Quote: ... 5 dpf larvae were fixed in 4% paraformaldehyde (PFA; Sigma) in phosphate-buffered saline (PBS ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 ng/ml of mouse recombinant IL-4 (Sigma-Aldrich), and 0.5 μg/ml anti-CD180 (RP/14 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 5 ng/ml mouse recombinant IL-4 (Sigma-Aldrich) to allow B cell activation and class switch recombination to IgG1 ...
-
bioRxiv - Neuroscience 2022Quote: ... 100μm of 4-AP (Sigma-Aldrich, CAS#: 504-24-5) was washed on for 3 minutes (the amount of time it took to regularly induce 4-AP oscillations ...
-
bioRxiv - Developmental Biology 2023Quote: ... followed by fixation in 4% formaldehyde (EMD Millipore FX0410-5) in 1X PBS with Triton X-100 (0.3% ...
-
bioRxiv - Immunology 2024Quote: ... or 4 mM EGTA (CAS 67-42-5, Sigma-Aldrich) were added to buffers as outlined in the text.
-
bioRxiv - Cancer Biology 2024Quote: ... and 5 μL of thrombin (4 units/ml, Sigma, UK) were mixed ...
-
bioRxiv - Neuroscience 2024Quote: ... 5′-cyclic monophosphate (dibutyryl cAMP) (Sigma-Aldrich, 60-92-4) and 2 ng/mL GDNF (Pepro Tech ...
-
Glycogen Synthase Kinase 3 regulates the genesis of the rare displaced ganglion cell retinal subtypebioRxiv - Neuroscience 2021Quote: ... and then a 30-min bath in 100 % DCM before being transferred in Di-Benzyl Ether (DBE; Sigma-Aldrich) overnight prior imaging.
-
bioRxiv - Molecular Biology 2021Quote: A CU RNA hairpin (5’-AAAAGAAAAGACGCGUAGUUUUCUACGCG- 3’) labeled with Cyanine 5.5 at the 5’-end (Millipore Sigma) was annealed in 20 mM HEPES ...
-
bioRxiv - Cell Biology 2021Quote: ... the 3’UTR of Polη (5’GCAAUGAGGGCCUUGAACA3’ from sigma-Aldrich) and Rev1 (5’CAGCGCAUCUGUGCCAAAGAA3’ from Sigma-Aldrich). For control ...
-
bioRxiv - Plant Biology 2023Quote: ... SD-WLH plates were supplemented with either 2.5 or 5 mM 3-amino-1,2,4-triazole (3-AT, Sigma-Aldrich).
-
bioRxiv - Cancer Biology 2024Quote: ... 5’ – CACCGCCGCCTCCGCGCTTCCCCGA – 3’ PIEZO1_sgRNAact_TSS143 (guide 3): 5’ – CACCGAGGCCCCAACGCACCAGGGC – 3’ Modified U251 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM; D5796, Sigma), supplemented with 10% foetal bovine serum (FBS ...
-
bioRxiv - Cancer Biology 2022Quote: ... then treated with 1 uM of 5-Aza-2-deoxycytidine (5 –Aza, SIGMA, A3656) or PBS for 4 days ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 mM 2-amino-5-phosphonopentanoic acid and 100 U/ml DNase (DN25, Sigma) for 25 min ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1.5 g/L (days 0-5 and days 11-14) or 2.5 g/L (days 6-10) NaHCO3 (Sigma-Aldrich), and 0.25 mM ascorbic acid (days 3-10) ...
-
bioRxiv - Immunology 2021Quote: ... or 0.5 μM/ml 5-amino-6-D-ribitylaminouracil (5-A-RU) (courtesy of Jeffrey Aubé, UNC) and 50 μM/ml Methylglyoxal (Sigma). Brefeldin A Solution (Biolegend ...
-
bioRxiv - Developmental Biology 2021Quote: Fish with mutations and transgenic background at 3.2 or 4 dpf were fixed 1 to 2 days at 4℃ with 4% paraformaldehyde (Sigma, P6148) in PBS ...
-
bioRxiv - Biochemistry 2024Quote: ... Sprtn KO was induced by treating 4×105 cells with methanol (MeOH) (vehicle control) or 2 μM (Z)-4-hydroxytamoxifen (4-OHT) (Sigma) for 48 h ...
-
bioRxiv - Immunology 2023Quote: ... 4 weeks after BM transplantation animals were injected with 5-FU (5-fluorouracil F6627, Sigma-Aldrich) at a dose of 150 mg/kg in 100ul of PBS ...
-
bioRxiv - Immunology 2024Quote: ... followed by 4 - 5 hours of stimulation by phorbol myristate acetate (PMA, 5 ng/ml, Sigma) and ionomycin (500 ng/ml ...
-
bioRxiv - Microbiology 2021Quote: ... Cell pellets were lysed in 3 ml BugBuster HT (Millipore, #70922-4) for 30 min at room temperature on a rotator ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 mM 3-isobutyl-1-methylxanthine (IBMX) (Sigma, Germany #28822-58-4). After 48 h the induction medium was replaced by the differentiation medium containing DMEM/Ham’s F12 ...
-
bioRxiv - Pathology 2021Quote: ... N″-triacetylchitotrioside [4-MU-β-(GlucNAc)3] (Sigma, St. Louis, MO, USA) as the substrate ...
-
bioRxiv - Bioengineering 2023Quote: ... and 4-(Methylnitrosoamino)-1-(3-pyridinyl)-1-butanone (NNK) (78013, Millipore-Sigma) (0.41 mg/dose ...
-
bioRxiv - Bioengineering 2023Quote: ... and 4-(Methylnitrosoamino)-1-(3-pyridinyl)-1-butanone (NNK) (78013, Millipore-Sigma) (0.41 mg/dose ...
-
bioRxiv - Neuroscience 2023Quote: ... D-Cyc (D-4-amino-3-isoxazolidone, 20 μg/μl; Sigma-Aldrich), AP5 (2-amino-5-phosphonopentanoate ...
-
bioRxiv - Neuroscience 2023Quote: ... testosterone-filled (4-androsten-17β-ol-3-one, Sigma Aldrich T-1500) Silastic tubes (2.16 OD x 1.02 ID ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... obtained by diluting testosterone (4- androsten-17b-ol-3-one; Sigma #86500) in commercial sesame to a concentration of 4 µg/µL ...
-
bioRxiv - Bioengineering 2024Quote: ... (4) the same supplemented with 3 μM free chloroquine diphosphate (Millipore Sigma), (5 ...
-
bioRxiv - Plant Biology 2020Quote: ... 2 mM EDTA and 1 % [v/v] protein phosphatase inhibitor cocktail 2 and 3 (Sigma-Aldrich)) were added at a concentration of 2 mL/g tissue powder ...
-
bioRxiv - Cell Biology 2022Quote: ... 500 μM (±)-6-Hydroxy-2,5,7,8-tetramethylchromane-2-carboxylic acid (Trolox, Sigma-Aldrich, 238813) and 1 mM sodium azide in PBS to ensure that the biotinylation reaction does not proceed beyond 1 minute ...
-
bioRxiv - Plant Biology 2020Quote: ... Trolox (6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid) (Sigma-Aldrich, St. Louis, MO) served as an antioxidant standard and it was likewise suspended in DMSO at 10 mg/ml.
-
bioRxiv - Biophysics 2021Quote: ... hirtus culture was concentrated by centrifugation (1121 rpm, 2 min, Sigma 6-10) in an oil test cup ...
-
bioRxiv - Neuroscience 2021Quote: ... and 0.1 mg/ml of 40-6-diamidino-2-phenylindole (DAPI; Sigma-Aldrich) for 2h at RT ...
-
bioRxiv - Neuroscience 2022Quote: ... and 0.1 mg/ml of 40-6-diamidino-2-phenylindole (DAPI; Sigma-Aldrich) for 2 hours at room temperature ...
-
bioRxiv - Bioengineering 2023Quote: ... and 2 mg/ml 6-aminocaproic acid (ACA) (all purchased from Sigma–Aldrich). Control constructs with no anchors were simply cultured in DM without any mechanical fixation ...
-
bioRxiv - Neuroscience 2023Quote: ... 6-diamidino-2-phenylindole (DAPI) (0.1 μg/ml, Sigma-Aldrich, D8417, the USA). Fluorescent imaging was performed using an Olympus IX71 Fluorescence Microscope (Olympus ...
-
bioRxiv - Neuroscience 2024Quote: ... then stained with DAPI (41Z,6-diamidino-2-phenylindole; 1:1000; EMD Millipore) in blocking buffer for 10 minutes before three final washes ...
-
bioRxiv - Cell Biology 2024Quote: ... 6-diamidino-2-phenylindole (DAPI) to stain DNA (Fluoroshield, Sigma Aldrich, Cat # F6057), under a coverslip ...
-
bioRxiv - Microbiology 2023Quote: ... #6: HldE and substrate seduheptulose-7-phosphate (S7-P, 2 mM, Sigma-Aldrich) putative product = seduheptulose-7-phosphate (S-7-P) ...
-
bioRxiv - Cancer Biology 2021Quote: ... relative cell viability was determined using Thiazolyl Blue Tetrazolium Bromide (MTT)-conversion (Sigma) as per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: rho0 cells were generated using 25 ug/ml of ethidium bromide (Sigma, E7637). Small colonies were picked to be validated with the following two assays ...
-
bioRxiv - Bioengineering 2020Quote: ... supplemented with 10 mM MgCl2 and 0.5 mg/mL ethidium bromide (Sigma-Aldrich). For all samples ...
-
bioRxiv - Immunology 2023Quote: ... cells were cultured with 500 ng/ml of ethidium bromide (EtBr; Sigma−Aldrich) for 4 days and checked for mitochondrial and nuclear DNA content by RT-PCR ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... The lentiviral transduction of SFs was performed using Hexadimethrine Bromide/ Polybrene (Sigma, H9268) and transduction efficiency was calculated by the FITC positive cells in FACs Canto II Flow cytometer (BD Biosciences ...
-
bioRxiv - Physiology 2023Quote: ... with scopolamine methyl bromide (0.1 mg/kg body weight; #S8502, Sigma-Aldrich, Germany) to block muscarinic receptors (PSNS) ...
-
bioRxiv - Systems Biology 2023Quote: ... Treatment with 37.5 mM Triethyltin bromide (TET, a lipophilic F0F1-ATPase inhibitor; Sigma) allowed the determination of the non-phosphorylating respiration rate due to proton leakage (JTET) ...