Labshake search
Citations for Millipore Sigma :
1951 - 2000 of 9314 citations for SUMO2 3 Blocking Peptide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... 3 mM Na2-ATP (Sigma-Aldrich), 0.2 mM Na-GTP (Sigma-Aldrich) ...
-
bioRxiv - Genetics 2023Quote: ... Doxycycline (3 ug/ml, Sigma Aldrich) was added to induce TetO gene expression ...
-
bioRxiv - Bioengineering 2023Quote: ... or 3% BSA (Sigma-Aldrich, USA). 100,000 PEO4 cells were seeded on top of each coating and incubated for 2 ...
-
bioRxiv - Cell Biology 2023Quote: ... and 1-bromo-3-chloropropane (Sigma) using phase separation method.
-
bioRxiv - Physiology 2023Quote: ... and 3 mM glycine (Sigma, G7126) for one hour at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... and 3-Octanol (OCT, Sigma-Aldrich), which was diluted 1:10 in paraffin oil (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 3 μM CHIR99021 (Sigma-Aldrich). Stable cell lines were blasticidin (Fisher Scientific ...
-
bioRxiv - Systems Biology 2024Quote: ... DMS (3 μL, Sigma-Aldrich D186309) was added to the folded RNA solution and allowed for 2 min incubation at 37 °C ...
-
bioRxiv - Biochemistry 2024Quote: ... PI(3)P-16:0 (Sigma), PMA (Sigma) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3 µM CHIR99021 (SML1046; Sigma-Aldrich), 10 µM SB 202190 (S7076 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Palmitic Acid (Sigma, 57-10-3), Rapamycin (LC laboratories ...
-
bioRxiv - Cell Biology 2023Quote: ... and 3-octanol (OCT, Sigma, 218405). Approximately 100 flies were placed in the center compartment of the T-maze ...
-
bioRxiv - Immunology 2023Quote: ... and 3 μM CHIR99021 (Sigma, SML1046), with a final FBS concentration of 10% ...
-
bioRxiv - Biophysics 2023Quote: ... x 3/32 in (Sigma-Aldrich) and Elbow Luer connector male (Thistle Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... Biocytin (3 mg/ml, Sigma-Aldrich) was routinely added to the intracellular solution to allow for post-hoc confirmation of cell morphology and localization (Figure 1F).
-
bioRxiv - Molecular Biology 2023Quote: ... T3 hormone 3 µg/mL (Sigma), rhPDGF-AA 40 ng/mL (R&D Systems) ...
-
bioRxiv - Neuroscience 2023Quote: ... β3 tubulin (1:1000, Sigma #T8578), peripherin (1:1000 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 mM trolox (Sigma-Aldrich, 238813), 0.8% D-(+)- Glucose (Nacalai Tesque ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.01% Zwittergent 3-10 detergent (Sigma), 5mM Imidazole ...
-
bioRxiv - Developmental Biology 2023Quote: ... rabbit phosphohistone-3 (Millipore, 1:500), rabbit anti-active caspase (R&D ...
-
bioRxiv - Cell Biology 2023Quote: ... 1X phosphatase inhibitor cocktail 3 (Sigma), 500 nM okadaic acid ...
-
bioRxiv - Neuroscience 2023Quote: ... His•Tag® (Millipore, 70796-3), anti-APP C-Terminal Fragment (BioLegend ...
-
bioRxiv - Neuroscience 2024Quote: ... 3’-diaminobenzidine tetrahydrochloride (DAB; Sigma-Aldrich) as chromogen ...
-
bioRxiv - Microbiology 2024Quote: ... and anti-caspase 3 (Sigma-Aldrich) diluted 1,00 times with Can Get Signal Immunoreaction Enhancer Solution 1 (Toyobo ...
-
bioRxiv - Microbiology 2024Quote: ... D-3-phosphoglyceric acid (3PG) (Sigma) (concentrations ranging from 1 mM to 10 mM ...
-
bioRxiv - Developmental Biology 2024Quote: ... mounted in 3% methylcellulose (M0387, Sigma), and observed under a BX51 transparent light microscope (Olympus ...
-
bioRxiv - Developmental Biology 2024Quote: ... phosphatase inhibitors 2 and 3 (Sigma) and protease inhibitor cocktail (Complete ...
-
bioRxiv - Genetics 2024Quote: ... and 3 µM IWR1-endo (Millipore). Media was supplemented with 20 µM Y-27632 for the first week ...
-
bioRxiv - Cell Biology 2024Quote: ... 4-aminotrizole (3-AT) (A8056, Sigma).
-
bioRxiv - Cell Biology 2024Quote: ... 3 μM CHR99021 (SML1046, Sigma, USA), 10% KSR ...
-
bioRxiv - Immunology 2024Quote: ... 5uM MB-3 (Sigma-Aldrich, #M2449), and 5uM MG149 (Medchem Express ...
-
bioRxiv - Cancer Biology 2023Quote: ... siTTLL12_6: 5’- GGUUGUUCGUGUAUGAUGU-3’ (Sigma-Proligo).
-
bioRxiv - Biochemistry 2024Quote: ... K125E reverse: 5’-ttcgatgcggacctcctgggttttgatctc-3’ (Sigma) with the wild-type human connexin 26 pFast construct used for previous studies as the template for mutagenesis (Brotherton et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... 40 mL of 3% polyvinyl alcohol (3% w/v PVA) (Sigma-Aldrich CO., St. Louis, MO, USA) were added and the mixture was mechanically stirred at 600 rpm for 4 h (RW-20 ...
-
bioRxiv - Neuroscience 2020Quote: ... The sections were then placed in 0.025% 3-3’-diaminobenzidine tetrahydrochloride (DAB, Sigma-Aldrich, St. Louis, MO), 0.01M Imidazole (Fisher Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... The rANF single strands DNAs (5’-AGAGGTCATGAAGGACATT-3’ and 5’AATGTCCTTCATGACCTCT-3’) were purchased from Sigma Aldrich and annealed ...
-
bioRxiv - Neuroscience 2019Quote: ... The sections were then placed in 0.025% 3-3’-diaminobenzidine tetrahydrochloride (DAB, Sigma-Aldrich, St. Louis, MO), 0.01M Imidazole (Fisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: Mice were injected intraperitoneally with 3 mL of 3 % (v/v) thioglycolate (thioglycolic acid, Sigma-Aldrich, T3758) in PBS to elicit peritoneal macrophages using a 25G needle ...
-
bioRxiv - Biochemistry 2020Quote: ... P4 5’ CTTGTCGTCATCGTCTTTGTAGTCCTTGTC 3’ and P5 5’ CAGGAAACA GCTATGACCATG 3’ and KOD Hot Start DNA Polymerase (Millipore).
-
bioRxiv - Bioengineering 2020Quote: ... we added 200 μL of a freshly made 1-Ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC, Sigma-Aldrich) solution 2% w/v (corresponds to 10 mg EDC in 500 μL MES buffer ...
-
bioRxiv - Cell Biology 2021Quote: ... CEP192 knockdown was achieved by transfecting the oligo duplex: 5’-GGAAGACAUUUUCAUCUCUtt-3’ and 5’-AGAGAUGAAAAUGUCUUCCtt-3’ (Sigma).
-
bioRxiv - Biochemistry 2022Quote: ... The [5′-32P] cytidine 3′,5′-bisphosphate was prepared by incubating 1 mM cytidine 3′-monophosphate (Sigma) with 312.5 pmole [γ-32P] ATP (6000 Ci/mmol ...
-
bioRxiv - Bioengineering 2020Quote: ... pH 5.8 and reacted with 600 molar excess of 1-Ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC, Sigma) and 200 molar excess racemic aminomethylnicotine for 20h ...
-
bioRxiv - Synthetic Biology 2020Quote: ... coupled with the Supelco Discovery HS F5-3 HPLC column (150 ×2.1 mm × 3 µm) (Sigma Aldrich). Mobile phase A consisted of 10 mM ammonium formate ...
-
bioRxiv - Neuroscience 2020Quote: ... slices were placed into a diaminobenzidine (DAB) solution in dH20 (Sigma-Aldrich Fast 3–3’ Diaminobenzidine Tablets) for 2 minutes and then rinsed thoroughly with TBS to prevent further DAB reactions ...
-
bioRxiv - Molecular Biology 2021Quote: ... concentrated to ∼3 mg/mL using Amicon Ultra centrifugal filter (3 kDa molecular weight cut-off) (Millipore) and loaded onto the size-exclusion Superdex 75 10/300 GL (GE Healthcare ...
-
bioRxiv - Neuroscience 2023Quote: ... and 3 mM N6,2′-O-Dibutyryladenosine 3′,5′-cyclic monophosphate sodium salt (cAMP, #D0260, Sigma-Aldrich, USA). Electro medium consists of 1:1 DMEM/F-12 (#31331028 ...
-
bioRxiv - Systems Biology 2022Quote: ... 3 ml of supernatant were homogenized with 3 ml of ethyl acetate (Millipore Sigma, item number 270989). Organic and aqueous layers were separated by centrifugation at 3 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Signals (ΔCt) were normalized to GAPDH expression (GAPDHfw70 5’-CCACCCATGGCAAATCC-3’ and GAPDHrev70 5’-GATGGGATTTGCATTGATGACA-3’; Sigma). The amplification efficiencies were determined by serial dilution and calculated as E = 10-1/m × 100 ...
-
bioRxiv - Neuroscience 2023Quote: ... The eluates 1-3 were mixed and concentrated with Amicon Ultra-15 (Merck Millipore, MWCO 3 K) to protein concentrations of 44–162 µM.