Labshake search
Citations for Millipore Sigma :
1951 - 2000 of 9777 citations for Recombinant Human PDCD5 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... The human umbilical vein endothelial cells (HUVEC) were acquired from Sigma-Aldrich and maintained according to manufacturer instructions ...
-
bioRxiv - Microbiology 2021Quote: ... IgA from human serum (LOT number 0000085362) was purchased from Sigma-Aldrich, Germany ...
-
bioRxiv - Cancer Biology 2022Quote: ... plasticware was coated using 10 µg/ml human plasma fibronectin (FN) (Millipore).
-
bioRxiv - Cell Biology 2022Quote: Mouse and Human liver sections on ITO glass (Sigma, Milwaukee, WI, US) were stored at -80ºC until analysis ...
-
bioRxiv - Cell Biology 2022Quote: ... gels were rehydrated overnight and coupled to human plasma fibronectin (FC010, Millipore) for 1 h at room temperature using the photoactivatable cross-linker Sulfo-Sanpah (22589 ...
-
bioRxiv - Microbiology 2020Quote: ... using the Non-Human Primate Cytokine MILLIPLEX map 23-plex kit (Millipore) according to the manufacturer’s instructions.
-
bioRxiv - Evolutionary Biology 2019Quote: ... and 1 mg/ml AAG (human a1-acid glycoprotein, Sigma, Cat # G9885). All medium is sterilized by filtration through a 0.22mm membrane ...
-
bioRxiv - Cell Biology 2019Quote: ... plates and flasks were coated with either: human plasma fibronectin (FN) (Millipore), collagen I (Col I ...
-
bioRxiv - Cancer Biology 2019Quote: ... rabbit polyclonal antibody against the human ZCCHC10 antigen (HPA038944, 1:2,000; Sigma), mouse monoclonal antibody against the FLAG antigen (F1804 ...
-
bioRxiv - Cancer Biology 2020Quote: ... followed by staining with specific antibodies recognizing human YB-1 (#HPA040304, Sigma), ER (SP1 ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... a rabbit anti-human EGFR monoclonal antibody (EMD Millipore-MERCK, Temecula, USA) diluted 1:1000 or a rabbit anti-human VEGF-A polyclonal antibody (Abcam ...
-
bioRxiv - Microbiology 2020Quote: ... using the Non-Human Primate Cytokine MILLIPLEX map 23-plex kit (Millipore) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2021Quote: ... 5 validated LAMP1 shRNAs were ordered from human Mission lentiviral library (Sigma). HEK293T/17 and A549 cells grown to ∼70% confluency in 6-well plates were transduced with 0.5 ng p24/well of shRNA pseudoviruses ...
-
bioRxiv - Systems Biology 2021Quote: ... were coated with 10 µg/ml fibronectin human plasma (Sigma, F2006-1MG) in PBS for 45 minutes at room temperature ...
-
bioRxiv - Cell Biology 2020Quote: Human dermal microvascular endothelial cells were maintained on gelatin (G1393; Sigma-Aldrich)-coated tissue-culture Petri dishes in endothelial cell growth Medium MV2 (Promocell ...
-
bioRxiv - Neuroscience 2020Quote: ... human tau constructs were expressed in the vector pNG2 (Merck-Novagen, Darmstadt) in E ...
-
bioRxiv - Immunology 2020Quote: ... using a custom human cytokine 31-plex panel (EMD Millipore Corporation, SPRCUS707). The panel included ...
-
bioRxiv - Immunology 2019Quote: ... Wells were washed and incubated with goat anti-human IgG-HRP (Sigma) diluted 1:2500 in blocking buffer for 1 hour at RT ...
-
bioRxiv - Cancer Biology 2019Quote: DMS-53 and H1048 human SCLC cells lysed in RIPA buffer (Millipore) containing protease inhibitor cocktail (Roche ...
-
bioRxiv - Cell Biology 2021Quote: ... Jurkat (ATCC) and U1301 (human T-cell leukemia cell line (01051619, Sigma) were used as short and long telomere controls ...
-
bioRxiv - Cell Biology 2021Quote: Human erythroleukemia K-562 cells were grown in RPMI-1640 medium (Sigma) supplemented with 10% FBS (Sigma ...
-
bioRxiv - Cancer Biology 2021Quote: ... A MILLIPLEX human cytokine 48-plex panel (Millipore Sigma HCYTA-60K-PX48) was run using supernatant from cells cultured in the presence or absence of poly I:C for 24 hours ...
-
bioRxiv - Immunology 2021Quote: ... resuspended in RPMI-1640 complete media containing 10% human AB serum (Sigma) at 2×106/mL and seeded onto 24 well flat bottom plates containing poly-L-Lysine (Sigma ...
-
bioRxiv - Immunology 2021Quote: ... or 1:3000 dilution of anti-human IgM (μ-chain-specific) (Sigma) antibody subtypes and 1:6000 dilution of anti-human IgG1 ...
-
bioRxiv - Cell Biology 2021Quote: ... Antibodies used were: pIgR (rabbit anti-human, Sigma, HPA012012, 1:1000 amplified), pIgR (goat anti-mouse ...
-
bioRxiv - Cancer Biology 2021Quote: ... The following primary antibodies were used: rabbit anti-human GAD1 (Sigma #HPA058412) mouse anti-human GPHN (Synaptic Systems #147011) ...
-
bioRxiv - Cell Biology 2020Quote: ... Culture plates were coated with 10 μg/mL human fibronectin (Millipore; FC010), 30 μg/mL BSA (Roche ...
-
bioRxiv - Microbiology 2021Quote: ... The human cerebral endothelial cell line hCMEC/D3 (Millipore-Sigma; SCME-004) used in this study was grown in EndoGRO complete medium with 5% fetal bovine serum and 1 ng/mL FGF-2 (fibroblast growth factor-2).
-
bioRxiv - Microbiology 2021Quote: ... The human cerebral endothelial cell line hCMEC/D3 (Millipore-Sigma; SCME-004) used in this study was grown in EndoGRO complete medium with 5% fetal bovine serum and 1 ng/mL FGF-2 (fibroblast growth factor-2).
-
bioRxiv - Microbiology 2020Quote: ... human lactoferrin (hLF) and bovine lactoferrin (bLF) were purchased from Sigma (USA).
-
bioRxiv - Immunology 2020Quote: ... 50 µM β-mercapthoethanol and 20 µg/ml human apotransferrin (Sigma Aldrich, St ...
-
bioRxiv - Immunology 2020Quote: ... Human serum minus (IgA/IgM/IgG) (Cod. S5393, Sigma, St. Louis, USA) was also used as a negative control in MNT and ELISA.
-
Highly Versatile, Non-Invasive Method for Collecting Buccal DNA from Free-Ranging Non-Human PrimatesbioRxiv - Genetics 2021Quote: ... a series of human placental DNA (Sigma-Aldrich, St. Louis, MO, USA) at concentrations of 500 ...
-
bioRxiv - Bioengineering 2022Quote: ... and collagen-IV from human placenta 5 mg/mL (#234154; Sigma-Aldrich) with HEPES (1M ...
-
ALiCE®: A versatile, high yielding and scalable eukaryotic cell-free protein synthesis (CFPS) systembioRxiv - Biochemistry 2022Quote: ... HRP-conjugated anti-mouse IgG or anti-human IgG detection antibodies (Sigma) were added at 1:10000 dilution with a final room temperature incubation for 1 hour ...
-
bioRxiv - Bioengineering 2022Quote: ... Human serum albumin (HSA, A1653) was purchased from Sigma-Aldrich (The Netherlands). Unless noted otherwise ...
-
bioRxiv - Bioengineering 2022Quote: Synthesized PEGαMA was reacted with thiolated human dECM and DTT (Sigma-Aldrich) crosslinkers off-stoichiometry (3:8 thiol to αMA ...
-
bioRxiv - Cell Biology 2022Quote: ... mice were injected with human chorionic gonadotropin (hCG) (Sigma Aldrich, Cat# CG5) 48 hours after PMSG injection to stimulate ovulation of Metaphase II-arrested eggs ...
-
bioRxiv - Immunology 2022Quote: ... 50 μM β-mercaptoethanol and 20 μg/ml human apotransferrin (Sigma Aldrich; depleted for human IgG with protein G sepharose) ...
-
bioRxiv - Immunology 2022Quote: ELISA plates were coated overnight with anti-human IgG (Sigma Aldrich I5260) at 1:5 000 in PBS ...
-
bioRxiv - Immunology 2022Quote: ... Binding was detected by polyclonal goat anti-human IgE-HRP (Sigma-Aldrich) or mouse anti-human IgG HRP (BD Pharmingen ...
-
bioRxiv - Molecular Biology 2023Quote: Normal Human Dermal Fibroblasts (NHDF) were purchased from Sigma (C-12302, Sigma). Cells were cultured in EMEM (ECB2071L ...
-
bioRxiv - Cell Biology 2022Quote: ... 1mM sodium pyruvate and 10 µg/ml human insulin (Cat# 19278, Sigma). HUVECs were a kind gift from Prof ...
-
bioRxiv - Cell Biology 2022Quote: shRNAs plasmids were purified from the MISSION® shRNA Human Library (Sigma). Non-targeting control shRNA (shCo ...
-
bioRxiv - Immunology 2022Quote: ... blocking of Fc receptors with human Ig (Sigma-Aldrich, St. Louis, MO); surface staining with mouse anti-human CD3-APC-H7 ...
-
bioRxiv - Immunology 2023Quote: ... Fc receptors were blocked with 10% normal human AB serum (Sigma-Aldrich). For analysis of neutrophil activation ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-human talin (mouse monoclonal, 8d4, Sigma Aldrich, T3287; WB 1:750), anti-human FAK (rabbit polyclonal ...
-
bioRxiv - Cancer Biology 2023Quote: ... were as follows: Human pLKO.1-puro-shRNAMAPK14 (Sigma SHCLNG-NM_001315; TRCN0000000511), Human pLKO.1-puro-shRNAMAPK11 (Sigma SHCLNG-NM_002751 ...
-
bioRxiv - Molecular Biology 2023Quote: ... human TLR3 (forward: FH2-TLR3; CAACAGAATCATGAGACAGAC; reverse: RH2-TLR3; CACTGTTATGTTTGTGGGTAG; Millipore Sigma), GUSB (forward ...
-
bioRxiv - Immunology 2023Quote: ... Fc receptors were blocked with 10% normal human AB serum (Sigma-Aldrich). To enrich for MSCs ...