Labshake search
Citations for Millipore Sigma :
1951 - 2000 of 3056 citations for N Acetyl Tizanidine d4 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Appropriate glycemic management protects the germline but not uterine environment in type 1 diabetesbioRxiv - Developmental Biology 2024Quote: Snap-frozen placental samples (n=25) were lyzed in TRI Reagent (Sigma-Aldrich) using the RETCH MM 400 Mixer Mill (Fisher Scientific ...
-
bioRxiv - Developmental Biology 2024Quote: WT and emx2el586/el586 heterozygous incrosses were incubated in 0.003% N-Phenylthiourea (Sigma). At 48 hpf ...
-
bioRxiv - Microbiology 2024Quote: ... 30 mM 3-(N-Morpholino)propanesulfonic acid (MOPS) (Sigma-Aldrich, Product No. 69947) was used as a buffering agent at pH at 7 during the experimental time course ...
-
bioRxiv - Neuroscience 2023Quote: ... mice received intraperitoneal injections of clozapine-N-oxide (CNO, Sigma, dissolved in saline) 10 minutes prior to the resident-intruder test.
-
bioRxiv - Neuroscience 2023Quote: ... Genotyping was performed with REDExtract-N-Amp (Sigma Aldrich, St. Louis, MO, USA) using primers JAX oIMR9462 ATGCTCCAGACTGCCTTGGGAAAAG ...
-
bioRxiv - Biochemistry 2023Quote: ... Negative control samples were prepared using 10 mM N-ethymaleimide (NEM, Sigma-Aldrich) instead of mPEG ...
-
bioRxiv - Physiology 2023Quote: ... DNA extraction was done using REDExtract-N-Amp Tissue PCR kit (XNAT, Sigma). For the PCR reaction ...
-
bioRxiv - Synthetic Biology 2023Quote: ... culture medium consisting of advanced DMEM/F12 supplemented with N-Acetylcysteine (Sigma-Aldrich), B plus supplement (bioGenous) ...
-
bioRxiv - Biophysics 2023Quote: ... sodium chloride and trimethylamine N-oxide (TMAO) were all purchased from Sigma-Aldrich as previously reported (15,18-23) ...
-
bioRxiv - Microbiology 2023Quote: ... E and/or N in the presence of 5 μg/ml polybrene (Millipore). 1 ml of each undiluted vector preparation was used for transduction of cells plated in one well ...
-
bioRxiv - Cell Biology 2023Quote: ... Coverslips were coated in Fibronectin (40µg/ml – ref. n°F1141 Merck/Sigma-Aldrich). WM1862 ...
-
bioRxiv - Cell Biology 2023Quote: ... containing 0.17mg/ml tricaine (ethyl-3-aminobenzoatemethanesulfonate, ref. n°E10521, Merck/Sigma-Aldrich). WM983B cells of different lysosome clustering status (spread ...
-
bioRxiv - Cell Biology 2023Quote: ... 5’-(N-Ethyl Carboxamide) adenosine (NECA) was purchased from Sigma-Aldrich (Cat. #119140), dissolved in DMSO to 10 mM stock ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were mounted using Mowiol mounting medium containing N-propyl gallate (Sigma-Aldrich). Primary antibodies used for immunofluorescence were rabbit anti CCDC15 (1:1000 ...
-
bioRxiv - Biochemistry 2023Quote: ... Samples were further derivatized with 10 μL tert-butyldimethylsilyl-N-methyltrifluoroacetamide (Sigma, 394882) and incubating at 70°C for 60 minutes.
-
bioRxiv - Bioengineering 2023Quote: ... Cell pellet was collected and suspended in N-Ethylmaleimide (NEM) solution (Sigma Aldrich), and the resulting cell suspension was precipitated ...
-
bioRxiv - Physiology 2023Quote: ... and plasma insulin (n=5) was analyzed by ELISA (EZRMI-13K, Sigma Aldrich), according to the manufacturer’s instructions.
-
bioRxiv - Bioengineering 2023Quote: ... in 50 mM of 2-(N-morpholino)ethanesulfonic acid (MES, Sigma-Aldrich Inc.) buffer (pH = 6) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: Male mice (n=25) were gavaged with tideglusib or 26% peg-400 (Sigma), 15% Cremophor EL (Sigma) ...
-
bioRxiv - Synthetic Biology 2024Quote: 3-O-C6-HSL (N-(B-Ketocaproyl)-L-Homoserine Lactone from Sigma-Aldrich, cat # K3007 ...
-
bioRxiv - Biophysics 2024Quote: ... A stock solution was made of 1M N-ethylmaleimide (NEM; Sigma-Aldrich, USA) dissolved in distilled water ...
-
bioRxiv - Cell Biology 2024Quote: ... The N-terminal hexahistidine tag was cleaved with ∼2 units of thrombin (Sigma) per 1 mg of protein ...
-
bioRxiv - Developmental Biology 2024Quote: ... specifically N-[2-(p-Bromocinnamylamino) ethyl]-5-isoquinolinesulfonamine dihydrochloride (H89, B1427, Sigma-Aldrich), were utilized in this study.
-
bioRxiv - Cell Biology 2024Quote: ... cells were mounted using Mowiol mounting medium containing N-propyl gallate (Sigma-Aldrich). Anti-CCDC66 antibody was generated by immunizing rats (Koc University ...
-
bioRxiv - Neuroscience 2024Quote: ... dechorionated at 24 hpf and incubated with 0.3% N-phenylthiourea (PTU; Sigma-Aldrich) to inhibit melanogenesis ...
-
bioRxiv - Neuroscience 2024Quote: ... Genotyping was conducted with RED Extract-N-Amp (Sigma-Aldrich, St. Louis, MO) using primers R1965 5′ GCT CAA GGT TGT ATG CCT TGG TGC T 3′ ...
-
bioRxiv - Biochemistry 2024Quote: ... with an N-terminal Myc-DKK tag and pETDuet-1 (Sigma-Aldrich, 71146) were used for expression in mammalian cells and bacteria ...
-
bioRxiv - Cell Biology 2024Quote: ... the lysates were supplemented with 20 mM N-ethylmaleimide (NEM; E3876, Sigma-Aldrich) and mixed with loading buffer without β-mercaptoethanol ...
-
bioRxiv - Plant Biology 2020Quote: ... 200 μl of N,O-Bis(trimethylsilyl)trifluoroacetamide+1% trimethylsilyl (BSTFA+1% TMCS, Sigma) were added and incubated at 110 °C for 15 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... Histones were extracted from nuclei by treatment with 0.4 N H2SO4 (Sigma 258105-500mL) for 30 minutes at room temperature and then precipitated from the supernatant by dropwise addition of ice-cold trichloroacetic acid (Sigma T069-100mL) ...
-
bioRxiv - Cell Biology 2020Quote: ... containing 50 µM phenylmethysulfonyl fluoride (PMSF) and 50 µM N-methylmaleimide (all Sigma-Aldrich), then sonicated and 10% v/v β-mercaptoethanol added (Sigma-Aldrich) ...
-
bioRxiv - Physiology 2022Quote: ... and glucose-6-phosphatase enzyme (catalog n°G8404, Sigma-Aldrich, Saint-Louis, MO, USA).
-
bioRxiv - Neuroscience 2019Quote: ... we also applied 5 mM QX-314 (Lidocaine N-ethyl bromide; Millipore Sigma, Canada) via the intracellular recording solution in order to block sodium (Salazar et al. ...
-
bioRxiv - Neuroscience 2019Quote: ... we conducted intraperitoneal (IP) injection or cannula infusion of Clozapine-N-Oxide (CNO, Sigma) to inactivate infected neurons or terminals before behavioral testing ...
-
bioRxiv - Developmental Biology 2019Quote: ... S4 are anti human Tcf7l2 (N-20, SCBT) and anti-gamma tubulin (T9026, Sigma) HRP coupled secondary antibodies (1/2,000 ...
-
bioRxiv - Neuroscience 2019Quote: Female fly heads (10 per N) were collected and homogenized in RIPA buffer (Sigma). 4X SDS loading buffer was added ...
-
bioRxiv - Microbiology 2019Quote: ... 3-(N-Morpholino) propanesulfonic acid (MOPS) was obtained from Sigma Aldrich (St. Louis, MO). YPD broth medium and YPD agar were obtained from Becton ...
-
bioRxiv - Cancer Biology 2019Quote: ... Control extracts were also incubated with 50 mM N-Ethyl Maleimide (NEM; Sigma-Aldrich) to inhibit any UbL conjugation ...
-
bioRxiv - Biophysics 2021Quote: ... 8 mg/mL unlabelled tubulin was incubated with 1 mM N-ethyl maleimide (Sigma) on ice for 10 mins ...
-
bioRxiv - Biophysics 2021Quote: We did antibody labelling following commercial protocols for (+)-Biotin N-hydroxysuccinimide ester (H1759, Sigma) and Alexa Fluor™ 488 NHS Ester (A20000 ...
-
bioRxiv - Biochemistry 2020Quote: ... Released N-glycans were labeled with 8-aminopyrene-1,3,6-trisulfonic acid (APTS, Sigma Aldrich), followed by a sample clean-up step (HILIC SPE ...
-
bioRxiv - Microbiology 2020Quote: ... and 0.1 µg/mL N-tosyl-L-phenylalanine chloromethyl ketone-trypsin (TPCK-trypsin, Sigma) and titered by viral plaque assay using MDCK cells as previously reported [29] ...
-
bioRxiv - Neuroscience 2020Quote: ... D2-ChR2 rats (n = 4) were anaesthetized with urethane (1.44 g kg−1, Sigma). The total dose was administered in three separate intraperitoneal injections ...
-
bioRxiv - Microbiology 2021Quote: ... A sample containing 0.5µg mRNA was applied directly onto the Hybond-N+ membrane (Millipore) and secured to the membrane by two treatment rounds in a HL-2000 HybrilinkerTM Hybridization Oven/UV Crosslinker (Analytik Jena US ...
-
bioRxiv - Microbiology 2020Quote: ... These S-o and S-n were cloned in to p3xFLAG-CMV-9 (Sigma) and pCMV3-SP-N-MYC (Sino Biological ...
-
bioRxiv - Microbiology 2020Quote: ... The water was buffered with 3-(N-Morpholino) propane sulfonic acid (MOPS, Sigma-Aldrich) to a final concentration of 1mM ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The final concentrations of drugs were: ATRA 0.1μM (cat n° R2625, Sigma-Aldrich Merck), SU5402 20μM (cat n° SML0444 ...
-
bioRxiv - Cell Biology 2022Quote: ... and 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine-N-(Cyanine 5) (DOPE-Cy5) (Sigma 810335C), all from Avanti Polar Lipids ...
-
bioRxiv - Cell Biology 2022Quote: ... 1 mg/mL of N-hydroxysuccinimide (NHS) ester dye (Atto 488 NHS Ester, Sigma) was mixed with 50 mM borate buffer (pH 9 ...
-
bioRxiv - Developmental Biology 2022Quote: ... samples were mounted in 80% glycerol containing 20 µg/ml N-propyl gallate (Sigma) or Vectashield mounting medium (Vector Laboratories ...