Labshake search
Citations for Millipore Sigma :
151 - 200 of 9400 citations for IL11 Mouse HEK293 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... Media were collected from HEK293 cells 48 hours after transfection and used for transductions in a final concentration of 8 ug/mL polybrene (Sigma-Aldrich, cat. TR-1003). Selection and maintenance of transduced cells was achieved with 5 ug/mL puromycin (Gibco ...
-
bioRxiv - Cell Biology 2023Quote: ... to validate the gene expression the plasmid (vide-supra) was transfected into HEK293 cells using PEI (Sigma-Aldrich/Merck Cat. No. 49553-93-7) following an optimized version of the standard protocol(Rajendra ...
-
bioRxiv - Biophysics 2023Quote: ... and human embryonic kidney 293 (HEK293) cells were obtained from the American Type Culture Collection (ATCC; Manassas, VA, USA) and maintained in DMEM (D5796, Sigma-Aldrich, St. Louis, MO), which was supplemented with 10% FBS (12676029 ...
-
Shear stress and very low levels of ligand synergize to activate ALK1 signaling in endothelial cellsbioRxiv - Cell Biology 2023Quote: ... tccagagaagcctaaagtgat) or non-targeted control (shCont, Cat: SHC002) were generated in HEK293 cells using the Sigma Mission system (Sigma-Aldrich, St. Louis, MO USA). HUVECs were seeded into a 6-well dish at a density of 80,000 cells per well ...
-
bioRxiv - Cancer Biology 2020Quote: ... Anti-mouse agarose or mouse agarose (both Sigma) were added for 1 hour at 40C prior to 3 washes in Lysis Buffer ...
-
bioRxiv - Neuroscience 2019Quote: ... Mouse anti-mouse NeuN (Millipore, MAB377, 1:100), and Rabbit Anti-MBP (Abcam ...
-
bioRxiv - Neuroscience 2023Quote: ... and Mouse-anti-mouse/rat-NeuN (1;200, Millipore). Secondary antibodies include Goat-anti-Chicken-IgG-488 (1:1000 ...
-
bioRxiv - Neuroscience 2020Quote: ... or anti-mouse IgG (mouse, A9044, 1:10000,Sigma) at room temperature for 1 h ...
-
bioRxiv - Cell Biology 2023Quote: ... Normal Mouse IgG (12-371, Sigma-aldrich, Mouse polyclonal).
-
bioRxiv - Cell Biology 2023Quote: ... Mouse anti-STIM1 (Novus) or mouse anti-FLAG (Sigma) were used for IF staining ...
-
bioRxiv - Cell Biology 2021Quote: ... 0.5 mg/mL mouse anti-Myc (EMD Millipore, 4A6 [mouse]), 1 mg/mL rabbit anti-Myc (EMD Millipore ...
-
bioRxiv - Neuroscience 2020Quote: ... mouse anti mouse Nestin (Millipore, product no: MAB353, (1:100)) ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-γ tubulin and mouse anti-a tubulin (Sigma). Goat anti-mouse IRDye 680RD and goat anti-rabbit IRDye 800CW (LI-COR Biosciences ...
-
bioRxiv - Plant Biology 2021Quote: ... anti-mouse (Sigma), 1:10,000 ...
-
bioRxiv - Cancer Biology 2021Quote: ... mouse IgG (Sigma), and rat IgG (Sigma).
-
bioRxiv - Plant Biology 2020Quote: ... anti-mouse (Sigma) or anti-rabbit peroxidase-conjugated (Merck Millipore ...
-
bioRxiv - Neuroscience 2019Quote: ... Flag (Mouse, Sigma), vGLUT1 (Guinea Pig ...
-
bioRxiv - Microbiology 2019Quote: ... β-actin (mouse, Sigma), GAPDH (mouse ...
-
bioRxiv - Neuroscience 2019Quote: ... Flag(mouse, Sigma), GST(rabbit ...
-
bioRxiv - Neuroscience 2019Quote: ... GFAP(mouse, Sigma), PSD-95(guinea pig ...
-
Lineage, Identity, and Fate of Distinct Progenitor Populations in the Embryonic Olfactory EpitheliumbioRxiv - Developmental Biology 2021Quote: ... pSMAD (Millipore, mouse), BrdU (BD ...
-
bioRxiv - Cancer Biology 2021Quote: ... Mouse IgG (Sigma), rat IgG (Sigma) ...
-
bioRxiv - Cell Biology 2021Quote: ... H3S10P (Mouse Millipore Cat#06570 multiple Lot# ...
-
bioRxiv - Physiology 2023Quote: ... Mouse IgG (Sigma) was used in littermates as a control treatment ...
-
bioRxiv - Molecular Biology 2024Quote: ... mouse mAb (Sigma) at 1:1000 (only used for Figure S1).
-
bioRxiv - Immunology 2024Quote: ... Mouse IgG (Sigma) or rat IgG (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... mouse anti-human/mouse SMA-Cy3 (1:200, #C6198, Sigma Aldrich), rat anti-mouse CD35 (1:100 ...
-
bioRxiv - Biochemistry 2020Quote: Mouse anti-FLAG M1 antibody and mouse anti-Sulfotyrosine antibody (Sigma) were used to detect the purified wild type C5aR and C5aRΔTyr with Y11F and F14F mutations respectively in the western blotting assays.
-
bioRxiv - Neuroscience 2020Quote: ... and mouse anti-β-actin (Sigma, mouse monoclonal antibody, 1:5000). After incubation with HRP-conjugated secondary antibodies ...
-
bioRxiv - Neuroscience 2019Quote: ... monoclonal mouse anti-mouse GFAP (1:2000; Sigma G-A-5), and monoclonal rat anti-mouse IL-6 (1:50 ...
-
bioRxiv - Neuroscience 2023Quote: ... and mouse anti-β-actin (Sigma, mouse monoclonal antibody, 1:5000). After incubation with HRP-conjugated secondary antibodies ...
-
bioRxiv - Immunology 2023Quote: ... Mouse Monoclonal anti-mouse Glutamin Synthetase (GS-6, 1:250, Millipore), Rabbit Polyclonal anti-SDS (PA5-58704) ...
-
bioRxiv - Neuroscience 2024Quote: ... mouse anti-NeuN (mouse monoclonal, 1:400, Millipore; catalog #MAB377, RRID:AB_2298772). This step was followed by incubation with secondary antibodies for 2h at RT to visualize primary antibodies ...
-
bioRxiv - Neuroscience 2020Quote: ... and then incubated with anti-mouse NeuN or anti-mouse parvalbumin (Millipore, MAB377 ...
-
bioRxiv - Neuroscience 2020Quote: ... and 3) mouse anti-NeuN (mouse monoclonal, Millipore, cat # MAB377, 1:100); and mouse anti-S100β (Sigma S2532 ...
-
bioRxiv - Microbiology 2021Quote: ... a mouse anti-FLAG primary (Sigma Mouse Anti-FLAG M2 monoclonal antibody) was used ...
-
bioRxiv - Neuroscience 2020Quote: ... mouse anti-mouse β-tubulin III (1:400, Millipore Sigma, catalog T2200), mouse humanized anti-GM2 (1:400 ...
-
bioRxiv - Immunology 2022Quote: ... ng mouse IgG was generated using purified mouse IgG (Sigma Cat #15381); absorbance values from this standard curve were used to convert sample absorbance signals into mass equivalents for both anti-S and anti-N antibodies ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-pERK1/2 (T185/Y187) and mouse anti-Flag M2 (Sigma); and mouse anti-H3 and rabbit anti-H3K4 trimethyl (Active Motif).
-
bioRxiv - Cancer Biology 2022Quote: ... For metastases delimitation cytokeratin (mouse anti-mouse cytokeratin pan-mixture, ascites, Sigma) and luciferase (rabbit anti-firefly luciferase ...
-
bioRxiv - Cell Biology 2020Quote: ... Mouse anti-HA (Sigma) was used at 1:1000 ...
-
bioRxiv - Neuroscience 2020Quote: ... αFlag (mouse, F1804, Sigma), αFlag-HRP (mouse ...
-
bioRxiv - Microbiology 2020Quote: ... mouse anti-HA (Sigma, H3663 ...
-
bioRxiv - Molecular Biology 2021Quote: ... mouse-anti-FLAG (Sigma), rabbit-anti-HA (Sigma) ...
-
bioRxiv - Genomics 2020Quote: ... raised in mouse (Millipore), according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2020Quote: ... anti-mouse IgG (Sigma) for VHA-B and chemiluminescent substrate (Peqlab) ...
-
bioRxiv - Developmental Biology 2019Quote: ... mouse anti-MLH1 (Millipore). Images were collected using a DeltaVision system (Applied Precision ...
-
bioRxiv - Cancer Biology 2020Quote: ... RalB (mouse, 04037; Millipore). The following secondary antibodies were used ...
-
bioRxiv - Cancer Biology 2020Quote: ... α-tubulin (mouse, CP06; Millipore) and Secondary horseradish peroxidase -linked antibodies ...
-
bioRxiv - Cancer Biology 2020Quote: ... RalB (mouse, 04037; Millipore), Glypican 4 (Rabbit ...