Labshake search
Citations for Millipore Sigma :
151 - 200 of 10000+ citations for 6 FLUORO 1 HEXANOL since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... 4’,6-diamidino-2-phenylindole (DAPI, 1:1000, Sigma) was used to show nuclei clear and dyed for 5 min ...
-
bioRxiv - Developmental Biology 2020Quote: ... anti acetylated α-tubulin (clone 6-11B-1; Sigma); anti-α-tubulin (DM1A ...
-
bioRxiv - Cell Biology 2022Quote: ... and acetylated-tubulin (mAb 6-11B-1, Sigma-Aldrich) were commercially bought (SI Appendix ...
-
bioRxiv - Cell Biology 2023Quote: ... diluted 1:300 and 6-11 B1 (Sigma-Aldrich), an anti- acetylated α-tubulin antibody (1:2000 ...
-
bioRxiv - Developmental Biology 2023Quote: ... 4′,6′-diamidino-2-phenylindole (1:3000; Sigma-Aldrich) was used to counterstain sections and coverslips were mounted using Fluorogel l (Electron Microscopy Sciences ...
-
bioRxiv - Pathology 2023Quote: ... acetylated tubulin (T7451, clone 6-11B-1; Sigma-Aldrich), and gp91phox (Abcam ...
-
bioRxiv - Cell Biology 2023Quote: ... and 6 mg ml−1 glucose (Sigma-Aldrich, G8270), incubated for 5 min ...
-
bioRxiv - Cell Biology 2023Quote: ... T6793 antibody (Clone 6-11B-1, mouse, Sigma-Aldrich) was used at 1:400 dilution ...
-
bioRxiv - Molecular Biology 2024Quote: ... corticosterone 1 µM (Sigma-Aldrich, cat# 50-22-6), Wy14643 10 µM (TCI chemicals ...
-
Nanoscale molecular architecture controls calcium diffusion and ER replenishment in dendritic spinesbioRxiv - Neuroscience 2021Quote: ... and in addition of 5′fluoro-2-deoxyuridine + uridine (FUDR) (Sigma; 20 μg and 50 μg/ml, respectively), to block glial proliferation ...
-
bioRxiv - Physiology 2022Quote: ... L4 staged worms were picked onto NGM plates containing 49.5 μM 5-fluoro-2’-deoxyuridine (FUDR, Sigma F0503), 50 μg/ml carbenicillin ...
-
bioRxiv - Immunology 2023Quote: ... and dexamethasone (DEX, (11β, 16α)-9-fluoro-11,17,21-trihydroxy-16-methylpregna-1,4-diene-3) were obtained from Sigma-Aldrich Korea (Seoul ...
-
bioRxiv - Developmental Biology 2023Quote: ... sections were mounted with Fluoro-KEEPER Antifade Reagent (Nakalai Tesque) after DAPI staining (5 μg/ml, Sigma-Aldrich). Images were captured using a Stellaris 5 (Leica ...
-
bioRxiv - Microbiology 2021Quote: ... 6-BAP (6-Benzylaminopurine, Sigma-Aldrich) was dissolved in 10mM NaOH and added to PDA media of full ...
-
bioRxiv - Neuroscience 2021Quote: ... 6-hydroxydopamine (6-OHDA; Sigma-Aldrich) was dissolved freshly into sterile 0.9% NaCl and 0.2% ascorbic acid immediately prior to administration to minimize oxidation ...
-
bioRxiv - Developmental Biology 2019Quote: ... diluted at 1:500 and acetylated-tubulin antibody (Sigma-Aldrich, 6-11B-1) at 1:500 ...
-
bioRxiv - Developmental Biology 2021Quote: ... 1:800 mouse anti-acetylated tubulin (clone 6-11B-1, Sigma, cat. T6793), 1:50 mouse anti-Synapsin (clone 3C11 ...
-
bioRxiv - Genetics 2022Quote: ... and mouse anti-acetylated tubulin (1:5000, Sigma-Aldrich, clone 6-11B-1). Slides were washed three times in PBS and subsequently incubated for 1 h at room temperature in blocking buffer containing the secondary antibodies conjugated to Ig-Alexa Fluor 568 ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-acetylated tubulin clone 6-11B-1 (1:500, Sigma-Aldrich, T6793), mouse anti-gamma tubulin GTU-88 (1:500 ...
-
bioRxiv - Cell Biology 2022Quote: ... and mouse anti-acetylated tubulin at 1:1000 (6-11B-1, Sigma-Aldrich). Fluorescent secondary antibodies conjugated to AlexaFluor488 and AlexaFluor564 were used at 1:500 (Invitrogen) ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse monoclonal anti-acetylated tubulin (Sigma-Aldrich, clone 6-11B-1, 1:1000) rabbit polyclonal anti-POC5 (A303-341A-T ...
-
bioRxiv - Developmental Biology 2019Quote: ... mouse anti-acetylated α-tubulin (1:2,000; 6–11B-1; Sigma-Aldrich T6793), rat anti–E-cadherin (1:1,000 ...
-
bioRxiv - Cell Biology 2019Quote: Transcription of rDNA was monitored by revealing the incorporation of 5-Fluoro-Uridine in Nascent RNA (5-FUrd, Sigma). Cells were incubated in presence of 2mM 5FUrd for 20 minutes followed by fixation in 4% FA (Sigma) ...
-
Naked Mole-Rat Hematopoietic Stem and Progenitors are Highly Quiescent with an Inherent Myeloid BiasbioRxiv - Cell Biology 2021Quote: Mice aged 6 months or naked mole-rats aged 2-4 years were intraperitoneally (i.p.) injected with 1mg (2′S)-2′-Deoxy-2′-fluoro-5-ethynyluridine (F-ara-EdU; Sigma) from a 10mg/ml stock in DMSO diluted with sterile 0.9% sodium chloride solution (Sigma).
-
bioRxiv - Genetics 2020Quote: ... nematodes were cultured and then assayed for survival on plates with 10 μg/ml 5-fluoro-2-deoxyuridine (Sigma), to avoid vulval rupture [27] and eliminate live progeny ...
-
bioRxiv - Neuroscience 2023Quote: ... A solution of 10 mM 5-fluoro-2’-deoxyuridine and uridine (anti-mitotic agent) (Sigma Aldrich, St. Louis, USA) was added to the cultures at days in vitro (DIV ...
-
bioRxiv - Developmental Biology 2020Quote: ... 6-diamidino-2-phenylindole (DAPI, 1:10,000 dilution, Sigma-Aldrich), mounted in 60% glycerol ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and 4′6-diamidino-2-phenylindole (1:5000, Sigma Aldrich). Images were acquired on a Leica DM5500B microscope equipped with a Leica DEC500 camera.
-
bioRxiv - Developmental Biology 2021Quote: ... acetylated tubulin (6-11B, 1:200, Sigma Aldrich ref. T6793) primary antibodies ...
-
bioRxiv - Cell Biology 2022Quote: ... 1×106-6×106 Cells were digested by Accuatse (Sigma) for 5 min at 37 °C and resuspended in 30% matrigel (Corning ...
-
bioRxiv - Cell Biology 2019Quote: ... and mouse anti-acetylated tubulin (6-11B-1; Sigma-Aldrich) at 1:200 ...
-
bioRxiv - Bioengineering 2020Quote: ... and 1 mg/ml 6-aminocaproic acid (ACA, Sigma-Aldrich).
-
bioRxiv - Cell Biology 2022Quote: ... and acetylated-α-tubulin (mAb 6-11B-1, Sigma-Aldrich) were commercially bought ...
-
bioRxiv - Bioengineering 2022Quote: ... and 1 mg/ml 6-aminocaproic acid (ACA, Sigma-Aldrich).
-
bioRxiv - Developmental Biology 2022Quote: ... 6-diamidino-2-phenylindole (DAPI, 1:10,000 dilution, Sigma-Aldrich). Images were obtained on a Nikon Eclipse Ti-U inverted fluorescent microscope (Nikon Instruments ...
-
bioRxiv - Neuroscience 2021Quote: ... mouse anti-GS (MAB302, clone GS-6, Millipore, 1:1000), mouse anti-NeuN (MAB377 ...
-
bioRxiv - Cell Biology 2019Quote: ... and acetylated-α-tubulin (1:5000; Sigma 6-11-B1). Conjugated secondary antibodies were purchased from Invitrogen Life Technologies (Carlsbad ...
-
bioRxiv - Cell Biology 2021Quote: ... acetylated α-tubulin (mAb 6-11B-1 T6793; Sigma-Aldrich;), S tag (EMD Millipore ...
-
bioRxiv - Neuroscience 2021Quote: ... 4’,6-diamidino-2-phenylindole (DAPI, 1:200; Sigma Aldrich) was used ...
-
bioRxiv - Microbiology 2021Quote: ... 2019-nCoV_N1 Probe (6-FAM / BHQ-1) ACCCCGCATTACGTTTGGTGGACC (Sigma Aldrich) for amplifying RNA from the SARS CoV-2 N-1 gene ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 4′6-diamidino-2-phenylindole (1:5000, Sigma Aldrich). Images were acquired on a Leica DM5500 microscope equipped with a Leica DEC500 camera.
-
bioRxiv - Microbiology 2022Quote: ... 6 mL of 1% crystal violet (CV) solution (Sigma-Aldrich) was added to the well and incubated for 15 min at 25 °C ...
-
bioRxiv - Neuroscience 2022Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI; 1:1000; Sigma) for nuclei counterstaining ...
-
bioRxiv - Molecular Biology 2023Quote: ... 6-diamidino-2-phenylindole (DAPI, Sigma Aldrich, D9542; 1:5000) and sections were mounted using an aqueous mounting medium ...
-
bioRxiv - Developmental Biology 2023Quote: ... Primary antibodies used included acetylated tubulin (6-11B-1, Sigma), MmIFT27 (33 ...
-
bioRxiv - Neuroscience 2023Quote: ... 6-diamidino-2-phenylindole (DAPI, 1 μg/ml, Sigma-Aldrich), washed twice with PBS and mounted with Vectashield mounting medium (Vector Laboratories) ...
-
bioRxiv - Bioengineering 2023Quote: ... 6-diamidino-2-phenylindole (DAPI) (Sigma Aldrich, 10236276001, 1:1000) in 0.1 M PBS for 15 min followed by a single wash for 10 min in 0.1 M PBS ...
-
bioRxiv - Microbiology 2023Quote: ... 4′,6-diamidino-2-phenylindole (DAPI; 1:1000; Sigma-Aldrich) was used for nuclei staining and added to the secondary antibody solution ...
-
bioRxiv - Developmental Biology 2023Quote: ... 4′,6-Diamidino-2-phenylindole dihydrochloride (DAPI) (1:1000; Sigma) was used as nuclear counterstaining ...
-
bioRxiv - Physiology 2022Quote: ... 0.5M K4[Fe(CN)6] and 0.5M K3[Fe(CN)6] with 1 mg/ml X-Gal diluted in DMF (all Sigma)) ...